Aborted (core dumped)

[amrdavila]

Hi !

Our reference database (protozoa) 3.9Gb size was successfully converted from fasta to Seq (tabular) format:

1 protozoa.genomic.fasta CTGACTAAGCATCCCTCTTAAAAGTCGAGGCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT
AACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTACCC
ATGAACCCTGACCCTAGCCCTAACCCTGGCCCTCAACTCGAACCCTAGCCCTAACCCTGGCCCTCAACTCGAACCCTAGCCCTAACCCTGACCCTAACGG
GTCAGGATAGGGTAATGAGAACCTGAACCGAAGCATGAACCCGAACCCTAG

then when trying to convert it to hash I got this error:

python3 hashSeq.py -i refseq_protozoa.seq --hash lsh -o refseq_protozoa.seq.hash -k 15
2019-12-10 09:51:38,757 - hashSeq - INFO - start converting...
2019-12-10 09:51:38,758 - hashSeq - INFO - parameters: {'f': <function convert..f at 0x7fbfac3fdea0>, 'lsh_file': '', 'create_lsh_only': False, 'batch_size': 100000, 'hash_size': 22, 'out_file': 'refseq_protozoa.seq.hash', 'in_file': 'refseq_protozoa.seq', 'n_thread': 39, 'kmer_size': 15, 'hash_fun': 'lsh', 'bucket': 20000000}
2019-12-10 09:51:38,758 - hashSeq - INFO - creating hash ...
terminate called after throwing an instance of 'std::out_of_range'
what(): map::at
Aborted (core dumped)

Any tips ?

[Lizhen0909]

I did not see your seq file, so can only guess.
If you are sure that it is in tabular format, the error is most probably because sequences contains chars that other than "ACGTN". ( I should have made this explicitly in doc)

In fastqToSeq.py, you may find something like sub_re.sub("N", ...) to convert non-ACGT chars to N. Since you prepared the tabular format by yourself, it is mostly likely because of this.