File tree Expand file tree Collapse file tree 1 file changed +0
-13
lines changed Expand file tree Collapse file tree 1 file changed +0
-13
lines changed Original file line number Diff line number Diff line change @@ -32,19 +32,6 @@ class TestContig < Test::Unit::TestCase
3232 assert_equal 1 , contig . dibase_composition [ :gn ]
3333 end
3434
35- should "benchmark composition" do
36- seq = "GCCGTGAGCTTCTTGATCGAGTTCTTCTCCCGCTTCGCGAACGCCTTGGACTCCTNGCACGGG"
37- seq << "GTCAGCCCCGCGATGTCGGCGGCCGCGGGCGGGGGG"
38- seq = seq * 100000
39- seq = Bio ::FastaFormat . new ">test\n " +seq
40- contig = Transrate ::Contig . new seq
41- ruby_time = 11 # time taken with the ruby version
42- c_time = Benchmark . realtime do |x |
43- contig . dibase_composition
44- end
45- assert c_time *100 < ruby_time , "c faster than ruby"
46- end
47-
4835 should "know how many of each two-base pair it contains" do
4936 assert_equal 3 , @contig . dibase_composition [ :cg ] , "cg count"
5037 assert_equal 3 , @contig . dibase_composition [ :at ] , "at count"
You can’t perform that action at this time.
0 commit comments