From d77be1d28a1b61732568873561884a1f7c790b88 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 29 Jan 2020 12:37:31 -0500 Subject: [PATCH 01/31] add tests for base RoslinQcOperator class --- Makefile | 1 + runner/operator/operator_factory.py | 4 +++- .../operator/roslin_qc_operator/__init__.py | 0 .../roslin_qc_operator/roslin_qc_operator.py | 16 +++++++++++++ .../test_roslin_qc_operator.py | 23 +++++++++++++++++++ .../tests/operator/test_operator_factory.py | 2 ++ 6 files changed, 45 insertions(+), 1 deletion(-) create mode 100644 runner/operator/roslin_qc_operator/__init__.py create mode 100644 runner/operator/roslin_qc_operator/roslin_qc_operator.py create mode 100644 runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py diff --git a/Makefile b/Makefile index a1dc5e185..d42d31ece 100644 --- a/Makefile +++ b/Makefile @@ -320,6 +320,7 @@ test: check-env python manage.py test \ runner.tests.operator.test_operator \ runner.tests.operator.test_operator_factory \ + runner.tests.operator.roslin_qc_operator.test_roslin_qc_operator \ runner.tests.operator.roslin_operator.test_pair_request \ runner.tests.test_port \ runner.tests.operator.roslin_operator.test_make_sample \ diff --git a/runner/operator/operator_factory.py b/runner/operator/operator_factory.py index 6057fc12a..3c22abfd2 100644 --- a/runner/operator/operator_factory.py +++ b/runner/operator/operator_factory.py @@ -1,8 +1,8 @@ from runner.operator.tempo_operator.tempo_operator import TempoOperator from runner.operator.roslin_operator.roslin_operator import RoslinOperator +from runner.operator.roslin_qc_operator.roslin_qc_operator import RoslinQcOperator from runner.operator.access_operator.access_operator import AccessOperator - class OperatorFactory(object): def factory(pipeline, request_id): @@ -12,6 +12,8 @@ def factory(pipeline, request_id): return RoslinOperator(request_id) elif pipeline in ('access',): return AccessOperator(request_id) + elif pipeline in ('roslin-qc',): + return RoslinQcOperator(request_id) else: raise Exception("Invalid pipeline") factory = staticmethod(factory) diff --git a/runner/operator/roslin_qc_operator/__init__.py b/runner/operator/roslin_qc_operator/__init__.py new file mode 100644 index 000000000..e69de29bb diff --git a/runner/operator/roslin_qc_operator/roslin_qc_operator.py b/runner/operator/roslin_qc_operator/roslin_qc_operator.py new file mode 100644 index 000000000..85ebab5dd --- /dev/null +++ b/runner/operator/roslin_qc_operator/roslin_qc_operator.py @@ -0,0 +1,16 @@ +from runner.operator.operator import Operator + +class RoslinQcOperator(Operator): + """ + Operator for Roslin QC pipeline + """ + + def __init__(self, request_id): + Operator.__init__(self, 'roslin-qc', request_id) + + def get_pipeline_id(self): + # TODO: replace this with the hard-coded pipeline id that will be created in database fixture + return "replace-this-with-pipeline-id" + + def get_jobs(self): + return([]) diff --git a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py new file mode 100644 index 000000000..7373ffdae --- /dev/null +++ b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py @@ -0,0 +1,23 @@ +""" +Tests for Roslin QC Operator class +""" +from django.test import TestCase +from runner.operator.operator_factory import OperatorFactory +from runner.operator.roslin_qc_operator.roslin_qc_operator import RoslinQcOperator +class TestOperatorFactory(TestCase): + def test_true(self): + self.assertTrue(True) + + def test_operator_factory_roslin_qc1(self): + """ + Test that a Roslin QC operator instance can be created + """ + pipeline_type = "roslin-qc" + request_id = "bar" + operator = OperatorFactory.factory(pipeline_type, request_id) + self.assertTrue(isinstance(operator, RoslinQcOperator)) + self.assertTrue( operator.pipeline_id == "replace-this-with-pipeline-id") + self.assertTrue( operator.operator == "roslin-qc") + self.assertTrue( operator.request_id == "bar") + self.assertTrue( operator._jobs == []) + self.assertTrue( len(operator.files) == 0) diff --git a/runner/tests/operator/test_operator_factory.py b/runner/tests/operator/test_operator_factory.py index 3fdda7edd..d93f180a5 100755 --- a/runner/tests/operator/test_operator_factory.py +++ b/runner/tests/operator/test_operator_factory.py @@ -95,3 +95,5 @@ def test_operator_factory_roslin3(self): self.assertTrue( operator.request_id == "bar") self.assertTrue( operator._jobs == []) self.assertTrue( len(operator.files) == 5) + + From 563009c729f537aca3afb742026cb56c7f5369e2 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Tue, 4 Feb 2020 10:24:58 -0500 Subject: [PATCH 02/31] add test to Makefile --- Makefile | 1 + 1 file changed, 1 insertion(+) diff --git a/Makefile b/Makefile index d42d31ece..b77d68dd3 100644 --- a/Makefile +++ b/Makefile @@ -321,6 +321,7 @@ test: check-env runner.tests.operator.test_operator \ runner.tests.operator.test_operator_factory \ runner.tests.operator.roslin_qc_operator.test_roslin_qc_operator \ + runner.tests.operator.roslin_qc_operator.test_input \ runner.tests.operator.roslin_operator.test_pair_request \ runner.tests.test_port \ runner.tests.operator.roslin_operator.test_make_sample \ From da2449a9f3f00efd0fd7d2a72ba6ce6cd97c4783 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 5 Feb 2020 10:50:32 -0500 Subject: [PATCH 03/31] update fixture dump script for dumping Run's --- .../tests/operator/test_operator_factory.py | 2 - scripts/dump_db_fixtures.py | 84 ++++++++++++++++--- 2 files changed, 73 insertions(+), 13 deletions(-) diff --git a/runner/tests/operator/test_operator_factory.py b/runner/tests/operator/test_operator_factory.py index d93f180a5..3fdda7edd 100755 --- a/runner/tests/operator/test_operator_factory.py +++ b/runner/tests/operator/test_operator_factory.py @@ -95,5 +95,3 @@ def test_operator_factory_roslin3(self): self.assertTrue( operator.request_id == "bar") self.assertTrue( operator._jobs == []) self.assertTrue( len(operator.files) == 5) - - diff --git a/scripts/dump_db_fixtures.py b/scripts/dump_db_fixtures.py index 4f7c7d1d1..0bf421121 100755 --- a/scripts/dump_db_fixtures.py +++ b/scripts/dump_db_fixtures.py @@ -17,6 +17,8 @@ $ dump_db_fixtures.py port_files fd41534c-71eb-4b1b-b3af-e3b1ec3aecde +$ dump_db_fixtures.py run --onefile ca18b090-03ad-4bef-acd3-52600f8e62eb + Output ------ @@ -34,7 +36,7 @@ import json import argparse import django -from django.db.models import Prefetch +from django.db.models import Prefetch, Max from django.core import serializers from pprint import pprint @@ -47,6 +49,17 @@ from runner.models import Run, RunStatus, Port, PortType, Pipeline sys.path.pop(0) +def get_file_filemetadata_from_port(port_instance): + """ + Get the queryset of all File and FileMetadata entries for a given Port entry + returns a tuple of type (files_queryset, filemetadata_queryset) + """ + files_queryset = port_instance.files.all() + # filemetadata_queryset = FileMetadata.objects.filter(file__in = [i for i in files_queryset]) + filemetata_instances = [] + for file in files_queryset: + filemetata_instances.append(FileMetadata.objects.filter(file = file).order_by('-version').first()) + return(files_queryset, filemetata_instances) def dump_request(**kwargs): """ @@ -73,22 +86,70 @@ def dump_run(**kwargs): Dump re-loadable Django database fixtures for a Run entry and its associated input and output Port entries """ runID = kwargs.pop('runID') + onefile = kwargs.pop('onefile') output_run_file = "{}.run.json".format(runID) - output_port_input_file = "{}.port.input.json".format(runID) - output_port_output_file = "{}.port.output.json".format(runID) + output_port_input_file = "{}.run.port.input.json".format(runID) + output_port_output_file = "{}.run.port.output.json".format(runID) + output_port_file_input_file = "{}.run.port_file.input.json".format(runID) + output_port_filemetadata_input_file = "{}.run.port_filemetadata.input.json".format(runID) + output_port_file_output_file = "{}.run.port_file.output.json".format(runID) + output_port_filemetadata_output_file = "{}.run.port_filemetadata.output.json".format(runID) + + all_data = [] + input_files = [] + input_filemetadatas = [] + output_files = [] + output_filemetadatas = [] # get the parent Run instance run_instance = Run.objects.get(id = runID) - print(json.dumps(json.loads(serializers.serialize('json', [run_instance])), indent=4), file = open(output_run_file, "w")) # get the Run input and output Port instances - input_queryset = run_instance.port_set.filter(port_type=PortType.INPUT) - print(json.dumps(json.loads(serializers.serialize('json', input_queryset.all())), indent=4), file = open(output_port_input_file, "w")) - - output_queryset = run_instance.port_set.filter(port_type=PortType.OUTPUT) - print(json.dumps(json.loads(serializers.serialize('json', output_queryset.all())), indent=4), file = open(output_port_output_file, "w")) - for item in output_queryset: - pprint((item, item.files.all())) + input_port_queryset = run_instance.port_set.filter(port_type=PortType.INPUT) + output_port_queryset = run_instance.port_set.filter(port_type=PortType.OUTPUT) + + for item in input_port_queryset: + files_queryset, filemetata_instances = get_file_filemetadata_from_port(item) + for file in files_queryset: + input_files.append(file) + for filemetadata in filemetata_instances: + input_filemetadatas.append(filemetadata) + + for item in output_port_queryset: + files_queryset, filemetata_instances = get_file_filemetadata_from_port(item) + for file in files_queryset: + output_files.append(file) + for filemetadata in filemetata_instances: + output_filemetadatas.append(filemetadata) + + # save each set of items to individual files by default + if onefile == False: + print(json.dumps(json.loads(serializers.serialize('json', [run_instance])), indent=4), file = open(output_run_file, "w")) + print(json.dumps(json.loads(serializers.serialize('json', input_port_queryset.all())), indent=4), file = open(output_port_input_file, "w")) + print(json.dumps(json.loads(serializers.serialize('json', output_port_queryset.all())), indent=4), file = open(output_port_output_file, "w")) + + print(json.dumps(json.loads(serializers.serialize('json', input_files)), indent=4), file = open(output_port_file_input_file, "w")) + print(json.dumps(json.loads(serializers.serialize('json', input_filemetadatas)), indent=4), file = open(output_port_filemetadata_input_file, "w")) + + print(json.dumps(json.loads(serializers.serialize('json', output_files)), indent=4), file = open(output_port_file_output_file, "w")) + print(json.dumps(json.loads(serializers.serialize('json', output_filemetadatas)), indent=4), file = open(output_port_filemetadata_output_file, "w")) + + # save all items to a single file + if onefile == True: + all_data.append(run_instance) + for item in input_port_queryset: + all_data.append(item) + for item in output_port_queryset: + all_data.append(item) + for item in input_files: + all_data.append(item) + for item in input_filemetadatas: + all_data.append(item) + for item in output_files: + all_data.append(item) + for item in output_filemetadatas: + all_data.append(item) + print(json.dumps(json.loads(serializers.serialize('json', all_data)), indent=4), file = open(output_run_file, "w")) def dump_port_files(**kwargs): @@ -186,6 +247,7 @@ def parse(): run = subparsers.add_parser('run', help = 'Dump output data for pipeline run') run.add_argument('runID', help = 'Run ID to dump items for') + run.add_argument('--onefile', action = "store_true", help = 'Put all the outputs into a single file ') run.set_defaults(func = dump_run) pipeline = subparsers.add_parser('pipeline', help = 'Dump pipeline fixture') From bd4bf071bff816544944cac7329a8cad89ce976d Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 5 Feb 2020 11:00:26 -0500 Subject: [PATCH 04/31] start Roslin QC operator and input parsing with tests and fixtures --- .gitignore | 1 + ...-03ad-4bef-acd3-52600f8e62eb.run.full.json | 6854 +++++++++++++++++ .../roslin_qc_operator/bin/__init__.py | 0 .../operator/roslin_qc_operator/bin/input.py | 282 + .../operator/roslin_qc_operator/test_input.py | 273 + 5 files changed, 7410 insertions(+) create mode 100644 fixtures/tests/ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json create mode 100644 runner/operator/roslin_qc_operator/bin/__init__.py create mode 100644 runner/operator/roslin_qc_operator/bin/input.py create mode 100644 runner/tests/operator/roslin_qc_operator/test_input.py diff --git a/.gitignore b/.gitignore index 8a87da525..e06df2f2d 100644 --- a/.gitignore +++ b/.gitignore @@ -7,3 +7,4 @@ db* scripts/*.json conda* input.json +scripts/*.json* diff --git a/fixtures/tests/ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json b/fixtures/tests/ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json new file mode 100644 index 000000000..d431bfe9c --- /dev/null +++ b/fixtures/tests/ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json @@ -0,0 +1,6854 @@ +[ + { + "model": "runner.run", + "pk": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "fields": { + "created_date": "2019-12-11T22:53:02.012Z", + "modified_date": "2020-01-14T23:03:35.530Z", + "name": "ROSLIN 09670_D, 22 of 54 (12/11/2019, 22:53:02)", + "app": "cb5d793b-e650-4b7d-bfcd-882858e29cc5", + "status": 4, + "execution_id": "df43cc77-bed4-4233-9817-6d12e25d9e1c", + "job_statuses": {}, + "output_metadata": { + "assay": "IDT_Exome_v1_FP_b37" + }, + "tags": { + "requestId": "09670_D" + } + } + }, + { + "model": "runner.port", + "pk": "6a3f41e3-e6f1-4d6f-a877-35c2247b82cb", + "fields": { + "created_date": "2019-12-11T22:53:17.822Z", + "modified_date": "2020-02-04T15:29:30.720Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "dbsnp", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://914dce04-bc41-427e-9b6c-3084bfa61250" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf", + "size": 2432705678, + "class": "File" + }, + "files": [ + "914dce04-bc41-427e-9b6c-3084bfa61250" + ] + } + }, + { + "model": "runner.port", + "pk": "704ee521-9779-4754-b270-ba8216f09c34", + "fields": { + "created_date": "2019-12-11T22:53:17.827Z", + "modified_date": "2020-02-04T15:29:30.724Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "indels_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://c868b6e9-92bd-4855-9726-7945e4471973" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf", + "size": 86369975, + "class": "File" + }, + "files": [ + "c868b6e9-92bd-4855-9726-7945e4471973" + ] + } + }, + { + "model": "runner.port", + "pk": "52e17010-65a2-4e7d-a699-03bfa8c7f62e", + "fields": { + "created_date": "2019-12-11T22:53:17.831Z", + "modified_date": "2020-02-04T15:29:30.750Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "snps_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://6f644f7f-a7b7-4573-a40a-6c5838f58b75" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf", + "size": 7313069069, + "class": "File" + }, + "files": [ + "6f644f7f-a7b7-4573-a40a-6c5838f58b75" + ] + } + }, + { + "model": "runner.port", + "pk": "b51ad3f0-e81f-45d6-a7ea-915939644abd", + "fields": { + "created_date": "2019-12-11T22:53:17.836Z", + "modified_date": "2020-02-04T15:29:30.924Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "cosmic", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://100204c9-c560-43d9-ab4d-8c03bc207f4e" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "size": 112402812, + "class": "File" + }, + "files": [ + "100204c9-c560-43d9-ab4d-8c03bc207f4e" + ] + } + }, + { + "model": "runner.port", + "pk": "e656d671-1873-4268-8f62-0e786496ff19", + "fields": { + "created_date": "2019-12-11T22:53:17.843Z", + "modified_date": "2020-02-04T15:29:31.049Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "exac_filter", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "class": "File", + "location": "bid://5c1dfb8e-d831-43f1-892b-f3c0bf043ca2" + }, + "value": { + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "size": 337197976, + "class": "File" + }, + "files": [ + "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2" + ] + } + }, + { + "model": "runner.port", + "pk": "fa222a47-ba06-4e04-8c4f-fb8cbbc29f18", + "fields": { + "created_date": "2019-12-11T22:53:17.802Z", + "modified_date": "2020-02-04T15:29:52.626Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "db_files", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "refseq": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "vep_data": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "vep_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "custom_enst": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_snps": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_vcf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "fp_genotypes": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "fp_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_list": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_exclude": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "bait_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "hotspot_list_maf": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "target_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers_bed": { + "type": [ + "null", + "array" + ], + "items": "string" + } + } + }, + "secondary_files": [], + "db_value": { + "refseq": { + "class": "File", + "location": "bid://3814d1da-e507-4e7d-b65b-b4ae7e07ec61" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "class": "File", + "location": "bid://584079c8-13af-4816-9ad3-50ce86e13934" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "class": "File", + "location": "bid://1edc9e89-8014-406f-92ee-74084eb981cd" + }, + "fp_intervals": { + "class": "File", + "location": "bid://b7c7d59f-73a4-4968-bbf5-cd6aed491b91" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "class": "File", + "location": "bid://e0e6283e-24ba-466f-9ec6-b6d9d85b2acd" + }, + "bait_intervals": { + "class": "File", + "location": "bid://a88b6dca-0601-4383-947f-27dbe8b83213" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "class": "File", + "location": "bid://92bff766-15fd-4316-8977-77afcef97dae" + }, + "target_intervals": { + "class": "File", + "location": "bid://c29140df-2bdf-4553-ba5d-b0bf07fb347e" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "value": { + "refseq": { + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.txt", + "size": 9953757, + "class": "File" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "size": 1015019014, + "class": "File" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.txt", + "size": 38179, + "class": "File" + }, + "fp_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_intervals.intervals", + "size": 50804, + "class": "File" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.tsv", + "size": 6984, + "class": "File" + }, + "bait_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_baits.ilist", + "size": 7083292, + "class": "File" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf", + "size": 624846, + "class": "File" + }, + "target_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_targets.ilist", + "size": 6997415, + "class": "File" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "files": [ + "1edc9e89-8014-406f-92ee-74084eb981cd", + "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "584079c8-13af-4816-9ad3-50ce86e13934", + "92bff766-15fd-4316-8977-77afcef97dae", + "a88b6dca-0601-4383-947f-27dbe8b83213", + "b7c7d59f-73a4-4968-bbf5-cd6aed491b91", + "c29140df-2bdf-4553-ba5d-b0bf07fb347e", + "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd" + ] + } + }, + { + "model": "runner.port", + "pk": "f4459608-f329-4ab9-bc30-a6c1ab31dcca", + "fields": { + "created_date": "2019-12-11T22:53:17.852Z", + "modified_date": "2020-02-04T15:29:52.795Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "curated_bams", + "port_type": 0, + "schema": { + "type": "array", + "items": [ + "null", + "array" + ] + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "class": "File", + "location": "bid://a0fa83e4-8f43-44ba-8dce-719c18bc33b9" + }, + { + "class": "File", + "location": "bid://1560276d-5d60-4bbf-bb16-2893fa5ec1b6" + }, + { + "class": "File", + "location": "bid://00e929a4-6ef8-46ca-ae7c-47fded158cbb" + }, + { + "class": "File", + "location": "bid://16aecbf7-94d8-4057-b6d0-409cf2d30f44" + }, + { + "class": "File", + "location": "bid://404e0dfd-b8c3-4c98-b07a-beadb4887939" + }, + { + "class": "File", + "location": "bid://e8dd7bdf-abfb-45e2-afd5-452ca86deb9d" + }, + { + "class": "File", + "location": "bid://07f85933-01ac-42f4-8c94-f751318e7376" + }, + { + "class": "File", + "location": "bid://0d64fb11-bc41-4963-9559-158411f15ce6" + }, + { + "class": "File", + "location": "bid://777be3e6-1cd5-4aef-a83d-db7061a11045" + }, + { + "class": "File", + "location": "bid://62373f4a-efc1-4ae7-8252-e5d4a91218ba" + }, + { + "class": "File", + "location": "bid://12ac7fba-2cbc-4ab5-b4c3-1fa44fc41e3e" + }, + { + "class": "File", + "location": "bid://b8f0c91b-9741-48dc-a617-7e4713819dc3" + }, + { + "class": "File", + "location": "bid://f05da7bc-d9ca-4a93-929f-4d52a09c19aa" + }, + { + "class": "File", + "location": "bid://d85ba214-e41d-4c0b-a7fd-d0c3cff0b052" + }, + { + "class": "File", + "location": "bid://45316ece-3691-4b9c-b636-3e02594580cf" + }, + { + "class": "File", + "location": "bid://aa352bb2-7209-4f14-9750-12e6c4f296ab" + }, + { + "class": "File", + "location": "bid://cc9c56f9-0432-4058-aec9-f61207718feb" + }, + { + "class": "File", + "location": "bid://b973583f-e8fd-4156-af89-852747dbce51" + }, + { + "class": "File", + "location": "bid://0978e54d-5f7e-4383-abcb-2cb675659c6b" + }, + { + "class": "File", + "location": "bid://cd114cae-5147-40a4-907f-82567b31bcc4" + }, + { + "class": "File", + "location": "bid://8eaf9fc4-c0fd-4d04-940d-754eac5f429e" + }, + { + "class": "File", + "location": "bid://b4583b1b-d570-4f92-a8f1-95a036c239f6" + }, + { + "class": "File", + "location": "bid://b1f6d1fd-163d-4616-8d15-67f888216e93" + }, + { + "class": "File", + "location": "bid://1998b585-d331-449b-b963-a8e42d64ec4b" + }, + { + "class": "File", + "location": "bid://8ad44576-6f3c-443d-84f2-71790469ce60" + }, + { + "class": "File", + "location": "bid://b89ed0be-70c6-4452-b98c-a6577ac07421" + }, + { + "class": "File", + "location": "bid://fdc12b20-3121-4176-afda-a161de7e5834" + }, + { + "class": "File", + "location": "bid://dd0a5f64-011c-4461-963e-ba85d529a2dd" + }, + { + "class": "File", + "location": "bid://507e913b-66fe-43a8-bbef-da9944556898" + }, + { + "class": "File", + "location": "bid://df51e7ab-0582-4e3b-9242-a95f0ba0fde8" + }, + { + "class": "File", + "location": "bid://f363912b-96b1-4898-94fb-025bd9e4d859" + }, + { + "class": "File", + "location": "bid://8808aeca-3a6d-478d-b4b5-a4818d624271" + }, + { + "class": "File", + "location": "bid://754edfb4-83bc-466f-99b3-c8d29f3bacd9" + }, + { + "class": "File", + "location": "bid://0eb765d1-797f-482e-ab3f-a5ec90416ec8" + }, + { + "class": "File", + "location": "bid://7afbce7f-0ae7-4120-8711-15de848a2bde" + }, + { + "class": "File", + "location": "bid://a3ef2b60-a2e3-40ee-b06a-d2c1580aaad2" + }, + { + "class": "File", + "location": "bid://e5f5ce8a-16e3-4310-afed-1e846bb4696b" + }, + { + "class": "File", + "location": "bid://91770ec9-d82c-45b2-9ce7-da18b67cb4c0" + }, + { + "class": "File", + "location": "bid://c5b27f38-4d0f-4fda-bf2d-c3c72fbbc3cf" + }, + { + "class": "File", + "location": "bid://316a84f9-1e44-4294-acd9-44007db6fa9d" + } + ], + "value": [ + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006284_N002_d.Group3.rg.md.abra.printreads.bam", + "size": 18001309333, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006537_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 13424642344, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006550_N002_d.Group1.rg.md.abra.printreads.bam", + "size": 13851651891, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006609_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 16764556278, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006610_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 17797687748, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006626_N001_d.Group19.rg.md.abra.printreads.bam", + "size": 15450048427, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006627_N001_d.Group20.rg.md.abra.printreads.bam", + "size": 21418934197, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006628_N001_d.Group15.rg.md.abra.printreads.bam", + "size": 20242506560, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006630_N001_d.Group14.rg.md.abra.printreads.bam", + "size": 18554952981, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006631_N001_d.Group17.rg.md.abra.printreads.bam", + "size": 17671380235, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006632_N001_d.Group16.rg.md.abra.printreads.bam", + "size": 17956822592, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006633_N001_d.Group13.rg.md.abra.printreads.bam", + "size": 14995930592, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006635_N001_d.Group8.rg.md.abra.printreads.bam", + "size": 19452196435, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006636_N001_d.Group9.rg.md.abra.printreads.bam", + "size": 19189450319, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006637_N002_d.Group0.rg.md.abra.printreads.bam", + "size": 10888838079, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006638_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 10088003650, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006639_N001_d.Group6.rg.md.abra.printreads.bam", + "size": 18437335538, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006640_N001_d.Group7.rg.md.abra.printreads.bam", + "size": 18781758639, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006641_N001_d.Group4.rg.md.abra.printreads.bam", + "size": 15954753147, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006642_N001_d.Group5.rg.md.abra.printreads.bam", + "size": 17579506808, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006643_N001_d.Group2.rg.md.abra.printreads.bam", + "size": 17298827865, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006644_N001_d.Group3.rg.md.abra.printreads.bam", + "size": 19302206744, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006645_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 15523622669, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006646_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 17007314582, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006647_N001_d.Group18.rg.md.abra.printreads.bam", + "size": 20776680414, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006648_N001_d.Group11.rg.md.abra.printreads.bam", + "size": 17232710261, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006649_N001_d.Group10.rg.md.abra.printreads.bam", + "size": 17366153538, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006650_N001_d.Group21.rg.md.abra.printreads.bam", + "size": 16571180154, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006904_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 18185638557, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006905_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 18558003865, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006906_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 16951748171, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006907_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 16389279357, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006996_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 10690676737, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 13862649385, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 11105358516, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.bam", + "size": 17582103301, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.bam", + "size": 19349236927, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.bam", + "size": 20668078544, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.bam", + "size": 18873117772, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.bam", + "size": 19501528278, + "class": "File" + } + ], + "files": [ + "00e929a4-6ef8-46ca-ae7c-47fded158cbb", + "07f85933-01ac-42f4-8c94-f751318e7376", + "0978e54d-5f7e-4383-abcb-2cb675659c6b", + "0d64fb11-bc41-4963-9559-158411f15ce6", + "0eb765d1-797f-482e-ab3f-a5ec90416ec8", + "12ac7fba-2cbc-4ab5-b4c3-1fa44fc41e3e", + "1560276d-5d60-4bbf-bb16-2893fa5ec1b6", + "16aecbf7-94d8-4057-b6d0-409cf2d30f44", + "1998b585-d331-449b-b963-a8e42d64ec4b", + "316a84f9-1e44-4294-acd9-44007db6fa9d", + "404e0dfd-b8c3-4c98-b07a-beadb4887939", + "45316ece-3691-4b9c-b636-3e02594580cf", + "507e913b-66fe-43a8-bbef-da9944556898", + "62373f4a-efc1-4ae7-8252-e5d4a91218ba", + "754edfb4-83bc-466f-99b3-c8d29f3bacd9", + "777be3e6-1cd5-4aef-a83d-db7061a11045", + "7afbce7f-0ae7-4120-8711-15de848a2bde", + "8808aeca-3a6d-478d-b4b5-a4818d624271", + "8ad44576-6f3c-443d-84f2-71790469ce60", + "8eaf9fc4-c0fd-4d04-940d-754eac5f429e", + "91770ec9-d82c-45b2-9ce7-da18b67cb4c0", + "a0fa83e4-8f43-44ba-8dce-719c18bc33b9", + "a3ef2b60-a2e3-40ee-b06a-d2c1580aaad2", + "aa352bb2-7209-4f14-9750-12e6c4f296ab", + "b1f6d1fd-163d-4616-8d15-67f888216e93", + "b4583b1b-d570-4f92-a8f1-95a036c239f6", + "b89ed0be-70c6-4452-b98c-a6577ac07421", + "b8f0c91b-9741-48dc-a617-7e4713819dc3", + "b973583f-e8fd-4156-af89-852747dbce51", + "c5b27f38-4d0f-4fda-bf2d-c3c72fbbc3cf", + "cc9c56f9-0432-4058-aec9-f61207718feb", + "cd114cae-5147-40a4-907f-82567b31bcc4", + "d85ba214-e41d-4c0b-a7fd-d0c3cff0b052", + "dd0a5f64-011c-4461-963e-ba85d529a2dd", + "df51e7ab-0582-4e3b-9242-a95f0ba0fde8", + "e5f5ce8a-16e3-4310-afed-1e846bb4696b", + "e8dd7bdf-abfb-45e2-afd5-452ca86deb9d", + "f05da7bc-d9ca-4a93-929f-4d52a09c19aa", + "f363912b-96b1-4898-94fb-025bd9e4d859", + "fdc12b20-3121-4176-afda-a161de7e5834" + ] + } + }, + { + "model": "runner.port", + "pk": "783ef68e-f360-49d8-aa65-1e8b4fda9740", + "fields": { + "created_date": "2019-12-11T22:53:17.808Z", + "modified_date": "2020-02-04T15:29:52.632Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "ref_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://96e3a791-2bc7-45f8-acc6-e519a29d5d0b" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta", + "size": 3189750467, + "class": "File" + }, + "files": [ + "96e3a791-2bc7-45f8-acc6-e519a29d5d0b" + ] + } + }, + { + "model": "runner.port", + "pk": "615b0226-6d3e-435f-888d-fe526984861f", + "fields": { + "created_date": "2019-12-11T22:53:17.814Z", + "modified_date": "2020-02-04T15:29:52.640Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "mouse_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://b6b418fe-6c83-43a2-8bdc-f3af2b0954a7" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta", + "size": 2769885087, + "class": "File" + }, + "files": [ + "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7" + ] + } + }, + { + "model": "runner.port", + "pk": "b7457771-aa9f-45eb-9d47-b2bac2ca9ce9", + "fields": { + "created_date": "2019-12-11T22:53:17.818Z", + "modified_date": "2020-02-04T15:29:52.648Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "hapmap", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://87b6a57c-f15b-49eb-9d22-d3893d2e00ef" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf", + "size": 225898391, + "class": "File" + }, + "files": [ + "87b6a57c-f15b-49eb-9d22-d3893d2e00ef" + ] + } + }, + { + "model": "runner.port", + "pk": "f0f57a14-4f34-4ab3-9d7e-8e5469462859", + "fields": { + "created_date": "2019-12-11T22:53:17.862Z", + "modified_date": "2020-02-04T15:29:52.797Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "runparams", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "genome": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "tmp_dir": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "intervals": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "mutect_rf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "complex_nn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "complex_tn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "covariates": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_type": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_cval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "mutect_dcov": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "num_threads": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "scripts_bin": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "abra_ram_min": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "abra_scratch": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_pcval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "gatk_jar_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "project_prefix": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "opt_dup_pix_dist": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "emit_original_quals": { + "type": [ + "null", + "array" + ], + "items": "boolean" + }, + "num_cpu_threads_per_data_thread": { + "type": [ + "null", + "array" + ], + "items": "int" + } + } + }, + "secondary_files": [], + "db_value": { + "genome": "GRCh37", + "tmp_dir": "/scratch", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.1, + "complex_tn": 0.2, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 100, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/scratch", + "facets_pcval": 500, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": [ + "09670_D" + ], + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "value": { + "genome": "GRCh37", + "tmp_dir": "/scratch", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.1, + "complex_tn": 0.2, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 100, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/scratch", + "facets_pcval": 500, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": [ + "09670_D" + ], + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "files": [] + } + }, + { + "model": "runner.port", + "pk": "a5388100-69f2-42eb-b2cc-ca02676e5ed9", + "fields": { + "created_date": "2019-12-11T22:53:17.869Z", + "modified_date": "2020-02-04T15:29:52.810Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "pair", + "port_type": 0, + "schema": { + "type": "array", + "items": "record" + }, + "secondary_files": [], + "db_value": [ + { + "CN": "MSKCC", + "ID": "s_C_K2902H_P001_d", + "LB": "09670_D_1_1_1_1_1", + "PL": "Illumina", + "PU": [ + "H7HCTBBXY_ACATACGG" + ], + "R1": [ + { + "class": "File", + "location": "bid://242cebfb-2b22-4e69-9cbf-478c4f026c3d" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://02cfb077-f61c-4659-9877-752c456e8f80" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_P001_d_H7HCTBBXY_ACATACGG" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_P001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_K2902H_N001_d", + "LB": "09670_D_46_1", + "PL": "Illumina", + "PU": [ + "H7FKJBBXY" + ], + "R1": [ + { + "class": "File", + "location": "bid://d320fc3a-07e6-46c6-88f4-ad6480cf446e" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://47be3848-e16b-4126-9e64-1d3f5a67b927" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_N001_d_H7FKJBBXY" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_N001_d.bam" + } + ], + "value": [ + { + "CN": "MSKCC", + "ID": "s_C_K2902H_P001_d", + "LB": "09670_D_1_1_1_1_1", + "PL": "Illumina", + "PU": [ + "H7HCTBBXY_ACATACGG" + ], + "R1": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz", + "size": 5966546453, + "class": "File" + } + ], + "R2": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz", + "size": 5832468368, + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_P001_d_H7HCTBBXY_ACATACGG" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_P001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_K2902H_N001_d", + "LB": "09670_D_46_1", + "PL": "Illumina", + "PU": [ + "H7FKJBBXY" + ], + "R1": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz", + "size": 3576965127, + "class": "File" + } + ], + "R2": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz", + "size": 3592299152, + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_N001_d_H7FKJBBXY" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_N001_d.bam" + } + ], + "files": [ + "02cfb077-f61c-4659-9877-752c456e8f80", + "242cebfb-2b22-4e69-9cbf-478c4f026c3d", + "47be3848-e16b-4126-9e64-1d3f5a67b927", + "d320fc3a-07e6-46c6-88f4-ad6480cf446e" + ] + } + }, + { + "model": "runner.port", + "pk": "3abd6a10-21d2-49be-bc83-31dd207759ec", + "fields": { + "created_date": "2019-12-11T22:53:17.971Z", + "modified_date": "2020-02-04T15:29:58.827Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "annotate_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 65612975, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "checksum": "sha1$0201d57f5fd370615df7ce8b78f49ae512692e0e", + "location": "bid://b835c33c-d241-42fc-beb2-e1ce1c41a77d", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants" + }, + "value": { + "size": 65612975, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "checksum": "sha1$0201d57f5fd370615df7ce8b78f49ae512692e0e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants" + }, + "files": [ + "b835c33c-d241-42fc-beb2-e1ce1c41a77d" + ] + } + }, + { + "model": "runner.port", + "pk": "d83323d6-f422-4656-a232-d552e780d170", + "fields": { + "created_date": "2019-12-11T22:53:18.030Z", + "modified_date": "2020-02-04T15:29:59.003Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "maf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 181310718, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "checksum": "sha1$15db27138a1586bf4f017b572154875c5ff129db", + "location": "bid://f9f55509-fcae-45f7-bdd2-72aebb59178e", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts" + }, + "value": { + "size": 181310718, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "checksum": "sha1$15db27138a1586bf4f017b572154875c5ff129db", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts" + }, + "files": [ + "f9f55509-fcae-45f7-bdd2-72aebb59178e" + ] + } + }, + { + "model": "runner.port", + "pk": "aad31466-a189-447d-a73e-3f582662b52b", + "fields": { + "created_date": "2019-12-11T22:53:17.873Z", + "modified_date": "2020-02-04T15:29:59.010Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "bams", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "size": 22899967017, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$d67cf2c24cacfeaa222893c5d4303aed55556457", + "location": "bid://e528ce76-0c6f-4088-8e22-38ece693bcdd", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6252264, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$776fc843bcdbd215452e611f03d7d9b42ad05a09", + "location": "bid://a0184edc-0a1c-40e7-9d41-69dda2e1e23e", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads" + } + ] + }, + { + "size": 14961505727, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$45f52cc5db96a9d90784ddcee324cedbe1ac5618", + "location": "bid://f6d0fd8d-cae6-469d-ab57-f22ab55178c9", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6010352, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$67a9aff1f1cd7be0240b7fefe740f7852dee4933", + "location": "bid://12ffa7a4-b853-452d-8076-fde5bac09aec", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads" + } + ] + } + ], + "value": [ + { + "size": 22899967017, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$d67cf2c24cacfeaa222893c5d4303aed55556457", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6252264, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$776fc843bcdbd215452e611f03d7d9b42ad05a09", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads" + } + ] + }, + { + "size": 14961505727, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$45f52cc5db96a9d90784ddcee324cedbe1ac5618", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6010352, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$67a9aff1f1cd7be0240b7fefe740f7852dee4933", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads" + } + ] + } + ], + "files": [ + "e528ce76-0c6f-4088-8e22-38ece693bcdd", + "f6d0fd8d-cae6-469d-ab57-f22ab55178c9" + ] + } + }, + { + "model": "runner.port", + "pk": "0be0ceba-0959-4173-a65c-0e6f13604211", + "fields": { + "created_date": "2019-12-11T22:53:17.876Z", + "modified_date": "2020-02-04T15:29:59.025Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "clstats1", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2641, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "checksum": "sha1$c3c14c67c47c1a9502a528685d8f24f1eda9dccd", + "location": "bid://0f1e06cb-c77b-4988-994f-797eab18cbea", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl" + }, + { + "size": 2611, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "checksum": "sha1$15260c3f7d8a521e7d2021f2581f8ffd96ff9519", + "location": "bid://48dd6384-7034-4cc7-9027-7df71496eb27", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl" + }, + { + "size": 2576, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "checksum": "sha1$ef853b586f31afefcabe8be9ba28bcddd5e47919", + "location": "bid://2c2b195f-514c-4107-af3a-8488cf6547ea", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl" + } + ], + [ + { + "size": 2764, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "checksum": "sha1$581103c999b49f012af12d4dd579a48ab7573991", + "location": "bid://2af79d18-4ba7-4aef-8505-bd775d47b00d", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl" + }, + { + "size": 2714, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "checksum": "sha1$fe2dd352e11bc48feefc6f7e1035ea0b5c8265dc", + "location": "bid://2a1736ce-50fd-4721-92da-474f67318c8d", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl" + } + ] + ], + "value": [ + [ + { + "size": 2641, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "checksum": "sha1$c3c14c67c47c1a9502a528685d8f24f1eda9dccd", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl" + }, + { + "size": 2611, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "checksum": "sha1$15260c3f7d8a521e7d2021f2581f8ffd96ff9519", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl" + }, + { + "size": 2576, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "checksum": "sha1$ef853b586f31afefcabe8be9ba28bcddd5e47919", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl" + } + ], + [ + { + "size": 2764, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "checksum": "sha1$581103c999b49f012af12d4dd579a48ab7573991", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl" + }, + { + "size": 2714, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "checksum": "sha1$fe2dd352e11bc48feefc6f7e1035ea0b5c8265dc", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl" + } + ] + ], + "files": [ + "0f1e06cb-c77b-4988-994f-797eab18cbea", + "2a1736ce-50fd-4721-92da-474f67318c8d", + "2af79d18-4ba7-4aef-8505-bd775d47b00d", + "2c2b195f-514c-4107-af3a-8488cf6547ea", + "48dd6384-7034-4cc7-9027-7df71496eb27" + ] + } + }, + { + "model": "runner.port", + "pk": "ba34a02a-0a12-4e50-a233-f962b644ac5e", + "fields": { + "created_date": "2019-12-11T22:53:17.879Z", + "modified_date": "2020-02-04T15:29:59.042Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "clstats2", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2818, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "checksum": "sha1$883cf9ba173211144550938349dfdbeefb6f38ee", + "location": "bid://e6d2247d-c056-467b-8ddb-6cf6e0387f26", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl" + }, + { + "size": 2815, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "checksum": "sha1$78e3a8aab3b20c83dee40acea967e25893ec2065", + "location": "bid://aecc788a-ebd8-4e3d-bb25-6bc6a373f5fa", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl" + }, + { + "size": 2775, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "checksum": "sha1$83cee0ca80ff374fd6049f9cbf475fb81a380d91", + "location": "bid://e0ad9888-930b-4c87-9797-a5a88894cb2a", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl" + } + ], + [ + { + "size": 2873, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "checksum": "sha1$2f9093a15e3a538e80653637690e0410779df620", + "location": "bid://75f8f49a-ffe7-4cf4-8956-0adacfe9f6f6", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl" + }, + { + "size": 2826, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "checksum": "sha1$e583971745676ccfbbb0b09474f74ecef10ea922", + "location": "bid://2a41fde8-172a-439c-8a9e-9681069c87fa", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl" + } + ] + ], + "value": [ + [ + { + "size": 2818, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "checksum": "sha1$883cf9ba173211144550938349dfdbeefb6f38ee", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl" + }, + { + "size": 2815, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "checksum": "sha1$78e3a8aab3b20c83dee40acea967e25893ec2065", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl" + }, + { + "size": 2775, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "checksum": "sha1$83cee0ca80ff374fd6049f9cbf475fb81a380d91", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl" + } + ], + [ + { + "size": 2873, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "checksum": "sha1$2f9093a15e3a538e80653637690e0410779df620", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl" + }, + { + "size": 2826, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "checksum": "sha1$e583971745676ccfbbb0b09474f74ecef10ea922", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl" + } + ] + ], + "files": [ + "2a41fde8-172a-439c-8a9e-9681069c87fa", + "75f8f49a-ffe7-4cf4-8956-0adacfe9f6f6", + "aecc788a-ebd8-4e3d-bb25-6bc6a373f5fa", + "e0ad9888-930b-4c87-9797-a5a88894cb2a", + "e6d2247d-c056-467b-8ddb-6cf6e0387f26" + ] + } + }, + { + "model": "runner.port", + "pk": "47ed87d7-ac01-4a86-96b5-3b3c795b375a", + "fields": { + "created_date": "2019-12-11T22:53:18.020Z", + "modified_date": "2020-02-04T15:29:59.046Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "maf_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 59073, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "checksum": "sha1$bc1d7f73cc72eecf3b13f88402d6952c92d933de", + "location": "bid://463c0311-e32f-40ae-a1a2-d831431997b7", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep" + }, + "value": { + "size": 59073, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "checksum": "sha1$bc1d7f73cc72eecf3b13f88402d6952c92d933de", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep" + }, + "files": [ + "463c0311-e32f-40ae-a1a2-d831431997b7" + ] + } + }, + { + "model": "runner.port", + "pk": "13610edb-6b99-41dd-8117-6b9df9f895dc", + "fields": { + "created_date": "2019-12-11T22:53:17.932Z", + "modified_date": "2020-02-04T15:29:59.053Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "qual_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8189, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$9ff5ad812b693a79512b12506f59d5d67df87c05", + "location": "bid://0fdc6110-b18f-4ef0-9c50-9905bf4a22a9", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8219, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$716fb1c1bcd8040ecc6e4452cbbae25a20435c52", + "location": "bid://9290ce2b-2dbd-4253-a4dd-9edf7fe79114", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "value": [ + { + "size": 8189, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$9ff5ad812b693a79512b12506f59d5d67df87c05", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8219, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$716fb1c1bcd8040ecc6e4452cbbae25a20435c52", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "files": [ + "0fdc6110-b18f-4ef0-9c50-9905bf4a22a9", + "9290ce2b-2dbd-4253-a4dd-9edf7fe79114" + ] + } + }, + { + "model": "runner.port", + "pk": "4f9ab52a-7061-4bde-bdf7-26a1f2d88bf1", + "fields": { + "created_date": "2019-12-11T22:53:17.892Z", + "modified_date": "2020-02-04T15:29:59.059Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "as_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2171, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.asmetrics", + "checksum": "sha1$7e891f9f68deedb83626c728109097d9c562f7a1", + "location": "bid://b9cd207a-f8d5-4c41-8506-f8bb6b0f61af", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 2134, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.asmetrics", + "checksum": "sha1$65ab3f206ead19b7ae3aa0eb4a9d1c5e7dff9843", + "location": "bid://22a814db-f3ad-4fb2-ae81-c56b41f01f13", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 2171, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.asmetrics", + "checksum": "sha1$7e891f9f68deedb83626c728109097d9c562f7a1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.asmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 2134, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.asmetrics", + "checksum": "sha1$65ab3f206ead19b7ae3aa0eb4a9d1c5e7dff9843", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.asmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "22a814db-f3ad-4fb2-ae81-c56b41f01f13", + "b9cd207a-f8d5-4c41-8506-f8bb6b0f61af" + ] + } + }, + { + "model": "runner.port", + "pk": "a5dd52ef-36be-42d0-a338-030be7e21fa3", + "fields": { + "created_date": "2019-12-11T22:53:17.997Z", + "modified_date": "2020-02-04T15:29:59.066Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_out", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 603, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$adf1df0bad06a20de898606152b4562d13de5fba", + "location": "bid://48a16d33-0fd4-41df-9bca-fe87c15c119e", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 602, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$f376bc7c0c427199a8319cbe95fc368abc914535", + "location": "bid://734731f7-a505-4aaa-957e-ce706342f555", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 603, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$adf1df0bad06a20de898606152b4562d13de5fba", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 602, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$f376bc7c0c427199a8319cbe95fc368abc914535", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "48a16d33-0fd4-41df-9bca-fe87c15c119e", + "734731f7-a505-4aaa-957e-ce706342f555" + ] + } + }, + { + "model": "runner.port", + "pk": "e110e9fc-3bef-42b7-a0ba-a4b8856ca8b9", + "fields": { + "created_date": "2019-12-11T22:53:17.986Z", + "modified_date": "2020-02-04T15:29:59.077Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_png", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 124853, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$aa3cfccae19203ef9fa352574ecdbf8db6b42d5a", + "location": "bid://a813b899-7525-480b-9a8d-fe844abf06cf", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 111084, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$dd13091946cb9b1ae3c002c0b86f8c1ca8f7bdea", + "location": "bid://9cbfedb0-dac4-4151-ac25-2553fc46fad6", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "value": [ + { + "size": 124853, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$aa3cfccae19203ef9fa352574ecdbf8db6b42d5a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 111084, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$dd13091946cb9b1ae3c002c0b86f8c1ca8f7bdea", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "files": [ + "9cbfedb0-dac4-4151-ac25-2553fc46fad6", + "a813b899-7525-480b-9a8d-fe844abf06cf" + ] + } + }, + { + "model": "runner.port", + "pk": "917e9d14-e93c-41ce-b46c-5e03774b2f59", + "fields": { + "created_date": "2019-12-11T22:53:18.005Z", + "modified_date": "2020-02-04T15:29:59.084Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_seg", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 4777, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$31d0a6687ac647922e9d67a0d2d6a28a7e16ec7a", + "location": "bid://1e25988d-2f5d-45bf-ab60-a3e8bf3b0811", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 3222, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$d15b1f7136fb9d107297f35abffd2ee9c9a229ac", + "location": "bid://97923d95-86f5-4f95-ab20-3cb7882b79cc", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 4777, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$31d0a6687ac647922e9d67a0d2d6a28a7e16ec7a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 3222, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$d15b1f7136fb9d107297f35abffd2ee9c9a229ac", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "1e25988d-2f5d-45bf-ab60-a3e8bf3b0811", + "97923d95-86f5-4f95-ab20-3cb7882b79cc" + ] + } + }, + { + "model": "runner.port", + "pk": "d3022dfb-3571-44b2-85ba-a3f6366a99ff", + "fields": { + "created_date": "2019-12-11T22:53:17.939Z", + "modified_date": "2020-02-04T15:29:59.091Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "gcbias_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6784, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "checksum": "sha1$4d1ed6c4bda99d26a031b9e9651f2f4abe8cfdd2", + "location": "bid://ad08e7ac-2877-41da-a16a-f468f3130158", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 6794, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "checksum": "sha1$010c3e9323875594fa4d4469c13b91db5a46e8cc", + "location": "bid://7694cc12-25c1-4585-93ce-fa5c540b5f17", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "value": [ + { + "size": 6784, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "checksum": "sha1$4d1ed6c4bda99d26a031b9e9651f2f4abe8cfdd2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 6794, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "checksum": "sha1$010c3e9323875594fa4d4469c13b91db5a46e8cc", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "files": [ + "7694cc12-25c1-4585-93ce-fa5c540b5f17", + "ad08e7ac-2877-41da-a16a-f468f3130158" + ] + } + }, + { + "model": "runner.port", + "pk": "acdf5eba-b287-4ecf-9db4-b9602d2854db", + "fields": { + "created_date": "2019-12-11T22:53:17.897Z", + "modified_date": "2020-02-04T15:29:59.098Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "hs_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5016, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "checksum": "sha1$d6ba79849a45f9fa69092453ada9f5992e7c0abb", + "location": "bid://4d8d1cf0-fc62-4ed6-a0bd-0dfbef86b277", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 5029, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "checksum": "sha1$2b08239d16dc6787ab37a7403313d46264877c7e", + "location": "bid://e4475a18-ce54-40c1-82cf-dd9323157658", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 5016, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "checksum": "sha1$d6ba79849a45f9fa69092453ada9f5992e7c0abb", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.hsmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 5029, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "checksum": "sha1$2b08239d16dc6787ab37a7403313d46264877c7e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.hsmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "4d8d1cf0-fc62-4ed6-a0bd-0dfbef86b277", + "e4475a18-ce54-40c1-82cf-dd9323157658" + ] + } + }, + { + "model": "runner.port", + "pk": "032f1e1c-25d0-447b-bbf1-d1df336c8c1a", + "fields": { + "created_date": "2019-12-11T22:53:17.920Z", + "modified_date": "2020-02-04T15:29:59.105Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "insert_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 13994, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$aa4d306c3b2327fe6e84ebf6b371ca79644ec649", + "location": "bid://ff35af28-dbe9-47e6-b55b-2d7d01c4cc63", + "nameroot": "s_C_K2902H_P001_d.rg.md.ismetrics" + }, + { + "size": 12712, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$5a57d43594e74ac8615409802377346f212e1cf7", + "location": "bid://8954096e-64c4-4393-9721-95c5b880b18b", + "nameroot": "s_C_K2902H_N001_d.rg.md.ismetrics" + } + ], + "value": [ + { + "size": 13994, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$aa4d306c3b2327fe6e84ebf6b371ca79644ec649", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.ismetrics" + }, + { + "size": 12712, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$5a57d43594e74ac8615409802377346f212e1cf7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.ismetrics" + } + ], + "files": [ + "8954096e-64c4-4393-9721-95c5b880b18b", + "ff35af28-dbe9-47e6-b55b-2d7d01c4cc63" + ] + } + }, + { + "model": "runner.port", + "pk": "6b0f48b8-432f-41cd-a148-04889e63b5c0", + "fields": { + "created_date": "2019-12-11T22:53:17.884Z", + "modified_date": "2020-02-04T15:29:59.117Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "md_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2900, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_P001_d.rg.md_metrics", + "checksum": "sha1$379ec0abb55e3b1ff9adb8ff82ed31689aa8062b", + "location": "bid://bdc504e0-bf83-4093-b14f-a6ce0ef94acc", + "nameroot": "s_C_K2902H_P001_d.rg" + }, + { + "size": 2866, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_N001_d.rg.md_metrics", + "checksum": "sha1$d2005e5e85d9e581671522c74548c8623d2c1979", + "location": "bid://11a1da3d-5dad-493f-83a5-c5d5fe14d39e", + "nameroot": "s_C_K2902H_N001_d.rg" + } + ], + "value": [ + { + "size": 2900, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_P001_d.rg.md_metrics", + "checksum": "sha1$379ec0abb55e3b1ff9adb8ff82ed31689aa8062b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md_metrics", + "nameroot": "s_C_K2902H_P001_d.rg" + }, + { + "size": 2866, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_N001_d.rg.md_metrics", + "checksum": "sha1$d2005e5e85d9e581671522c74548c8623d2c1979", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md_metrics", + "nameroot": "s_C_K2902H_N001_d.rg" + } + ], + "files": [ + "11a1da3d-5dad-493f-83a5-c5d5fe14d39e", + "bdc504e0-bf83-4093-b14f-a6ce0ef94acc" + ] + } + }, + { + "model": "runner.port", + "pk": "789915c8-14da-49ac-9249-b1e99ce1f5d3", + "fields": { + "created_date": "2019-12-11T22:53:17.956Z", + "modified_date": "2020-02-04T15:29:59.121Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "mutect_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 24213327, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$dc5d1aeb90cee217d736222d2dada308973832d6", + "location": "bid://dd8d50f9-389f-49e4-ae3a-17510322684c", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "value": { + "size": 24213327, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$dc5d1aeb90cee217d736222d2dada308973832d6", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "dd8d50f9-389f-49e4-ae3a-17510322684c" + ] + } + }, + { + "model": "runner.port", + "pk": "c4a65c71-128e-417b-a020-4edf6f2cfbe9", + "fields": { + "created_date": "2019-12-11T22:53:17.968Z", + "modified_date": "2020-02-04T15:29:59.125Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "combine_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 13440159, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "checksum": "sha1$11cb5a6370052fdfb1d83da53a7161cf3592e8f5", + "location": "bid://5d58f2d4-46dc-49f3-8e39-5c1e43a3d55b", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 430453, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$dd9315feeb320ec777dac7297b3a9bfc7a5d6c33", + "location": "bid://ae7708c1-6e92-480b-a550-5c847056e0ca", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz" + } + ] + }, + "value": { + "size": 13440159, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "checksum": "sha1$11cb5a6370052fdfb1d83da53a7161cf3592e8f5", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 430453, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$dd9315feeb320ec777dac7297b3a9bfc7a5d6c33", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz" + } + ] + }, + "files": [ + "5d58f2d4-46dc-49f3-8e39-5c1e43a3d55b" + ] + } + }, + { + "model": "runner.port", + "pk": "d112b0b3-24e1-47d4-b57f-0969412bd679", + "fields": { + "created_date": "2019-12-11T22:53:18.014Z", + "modified_date": "2020-02-04T15:29:59.129Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "merged_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 19739, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "checksum": "sha1$c016b28102cd0e828dda14b1dfca985f822849ed", + "location": "bid://d72930a5-6916-4d32-b9de-55c9e27a92df", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass" + }, + "value": { + "size": 19739, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "checksum": "sha1$c016b28102cd0e828dda14b1dfca985f822849ed", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass" + }, + "files": [ + "d72930a5-6916-4d32-b9de-55c9e27a92df" + ] + } + }, + { + "model": "runner.port", + "pk": "a5354486-b417-4b9a-9912-f8a297050b4b", + "fields": { + "created_date": "2019-12-11T22:53:18.026Z", + "modified_date": "2020-02-04T15:29:59.133Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "portal_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 5795, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "checksum": "sha1$14d8ca3da33d4d318fa5f5e2cdf77f8687a62148", + "location": "bid://2e0d7c0a-be9c-4969-a65e-0139e95ebdc1", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal" + }, + "value": { + "size": 5795, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "checksum": "sha1$14d8ca3da33d4d318fa5f5e2cdf77f8687a62148", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal" + }, + "files": [ + "2e0d7c0a-be9c-4969-a65e-0139e95ebdc1" + ] + } + }, + { + "model": "runner.port", + "pk": "bc60b89d-8146-4f31-8c62-65ccf93576d8", + "fields": { + "created_date": "2019-12-11T22:53:17.965Z", + "modified_date": "2020-02-04T15:29:59.137Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "vardict_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 403491742, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$cbcd1bd27821f1c527434bfe9abace8d3320819e", + "location": "bid://2167517e-4230-4660-a3e2-f1f53d492e60", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict" + }, + "value": { + "size": 403491742, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$cbcd1bd27821f1c527434bfe9abace8d3320819e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict" + }, + "files": [ + "2167517e-4230-4660-a3e2-f1f53d492e60" + ] + } + }, + { + "model": "runner.port", + "pk": "17a83add-f932-435f-aa7e-1898312cbd3a", + "fields": { + "created_date": "2019-12-11T22:53:18.003Z", + "modified_date": "2020-02-04T15:29:59.147Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_rdata", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8622126, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$1e47fce47992626a03fe84ebcb3e95a0fecea4f1", + "location": "bid://587840dc-bcb6-48e6-9000-ae912c415d7c", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 8618530, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$b990bfe8c0471672e76056a0f291b5d4ee81d4d9", + "location": "bid://c1b4ba39-e14b-4535-88f1-53de2f5809c9", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 8622126, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$1e47fce47992626a03fe84ebcb3e95a0fecea4f1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 8618530, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$b990bfe8c0471672e76056a0f291b5d4ee81d4d9", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "587840dc-bcb6-48e6-9000-ae912c415d7c", + "c1b4ba39-e14b-4535-88f1-53de2f5809c9" + ] + } + }, + { + "model": "runner.port", + "pk": "88c2cfc2-1379-436b-ae7e-381e9fa8d41d", + "fields": { + "created_date": "2019-12-11T22:53:17.928Z", + "modified_date": "2020-02-04T15:29:59.154Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "qual_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5494, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$dad5640a5406c875b7fdaf4103b6edc2f763be56", + "location": "bid://df4b1eb1-640f-486c-846f-6df01c5896ac", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5508, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$e804183b1e07cfa754330005de8ff5c864130a41", + "location": "bid://5ed9c450-1af5-422c-8c74-f60219ad3d26", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics" + } + ], + "value": [ + { + "size": 5494, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$dad5640a5406c875b7fdaf4103b6edc2f763be56", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5508, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$e804183b1e07cfa754330005de8ff5c864130a41", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics" + } + ], + "files": [ + "5ed9c450-1af5-422c-8c74-f60219ad3d26", + "df4b1eb1-640f-486c-846f-6df01c5896ac" + ] + } + }, + { + "model": "runner.port", + "pk": "07d8bc0d-2425-43b8-8a4f-281e6802f706", + "fields": { + "created_date": "2019-12-11T22:53:18.008Z", + "modified_date": "2020-02-04T15:29:59.158Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_counts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 32693698, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$a6f95a5e09c9e581321079f1f5fedd003ae5c221", + "location": "bid://262c3d19-2d59-403d-bd2b-66e0fe404413", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat" + }, + "value": { + "size": 32693698, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$a6f95a5e09c9e581321079f1f5fedd003ae5c221", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat" + }, + "files": [ + "262c3d19-2d59-403d-bd2b-66e0fe404413" + ] + } + }, + { + "model": "runner.port", + "pk": "70e4ee3c-e265-4c83-80db-d1719aada8f7", + "fields": { + "created_date": "2019-12-11T22:53:17.935Z", + "modified_date": "2020-02-04T15:29:59.164Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "doc_basecounts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 13779990, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$f2677685cda917f388dd395b7715d07ae1090ff4", + "location": "bid://dfc3e0f6-be3c-4a1c-a2b7-fc8fb8791b1d", + "nameroot": "s_C_K2902H_P001_d.rg.md_FP_base_counts" + }, + { + "size": 13586169, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$a218a74b136aac74f9227e6cea7720c14fb0abce", + "location": "bid://4c1e5a08-70c1-4dcf-9d4b-b4d0d67ba3a7", + "nameroot": "s_C_K2902H_N001_d.rg.md_FP_base_counts" + } + ], + "value": [ + { + "size": 13779990, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$f2677685cda917f388dd395b7715d07ae1090ff4", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_K2902H_P001_d.rg.md_FP_base_counts" + }, + { + "size": 13586169, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$a218a74b136aac74f9227e6cea7720c14fb0abce", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md_FP_base_counts" + } + ], + "files": [ + "4c1e5a08-70c1-4dcf-9d4b-b4d0d67ba3a7", + "dfc3e0f6-be3c-4a1c-a2b7-fc8fb8791b1d" + ] + } + }, + { + "model": "runner.port", + "pk": "ef869104-5820-4313-9d8d-59d0cb8278a0", + "fields": { + "created_date": "2019-12-11T22:53:17.942Z", + "modified_date": "2020-02-04T15:29:59.171Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "gcbias_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6648, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$bb7469356a97449579bdd25e0ab600d2a8fa426d", + "location": "bid://23fdfe62-3e90-4db4-b533-acadf2f4e1b2", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 6632, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$01cbb4e6bca86f1d857ccb6446b7188d6892d71a", + "location": "bid://b950c7ff-84c1-4476-99e1-6f0b16626f76", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 6648, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$bb7469356a97449579bdd25e0ab600d2a8fa426d", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 6632, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$01cbb4e6bca86f1d857ccb6446b7188d6892d71a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "23fdfe62-3e90-4db4-b533-acadf2f4e1b2", + "b950c7ff-84c1-4476-99e1-6f0b16626f76" + ] + } + }, + { + "model": "runner.port", + "pk": "fdbb93c3-2287-4491-bcaa-826a189b98be", + "fields": { + "created_date": "2019-12-11T22:53:17.946Z", + "modified_date": "2020-02-04T15:29:59.182Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "gcbias_summary", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 1201, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "checksum": "sha1$c6ca330351060e014b450e87b8fdd43731be79f6", + "location": "bid://3cab6e36-70f5-46df-aa00-a4473cb8ed50", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 1199, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "checksum": "sha1$1932d9f758e45392212f1cf3c08a07ba988bde8c", + "location": "bid://44f519d5-a59c-4baa-bf08-2792460c78bc", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "value": [ + { + "size": 1201, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "checksum": "sha1$c6ca330351060e014b450e87b8fdd43731be79f6", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbias.summary", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 1199, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "checksum": "sha1$1932d9f758e45392212f1cf3c08a07ba988bde8c", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbias.summary", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "files": [ + "3cab6e36-70f5-46df-aa00-a4473cb8ed50", + "44f519d5-a59c-4baa-bf08-2792460c78bc" + ] + } + }, + { + "model": "runner.port", + "pk": "c2bf6266-d610-42b5-a474-8e17f94ac159", + "fields": { + "created_date": "2019-12-11T22:53:17.908Z", + "modified_date": "2020-02-04T15:29:59.188Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "insert_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 7754, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics", + "checksum": "sha1$db6602f7efaf6fcce248ac81838e52c3e252fd24", + "location": "bid://c211d274-6cf8-4f37-a201-1441b3f3c716", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 7041, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics", + "checksum": "sha1$ea3bd53219598f06bbae0868dcf4ebbcc38a4a5e", + "location": "bid://8265b3ed-0c3c-496c-ab97-ea312cf878db", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 7754, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics", + "checksum": "sha1$db6602f7efaf6fcce248ac81838e52c3e252fd24", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.ismetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 7041, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics", + "checksum": "sha1$ea3bd53219598f06bbae0868dcf4ebbcc38a4a5e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.ismetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "8265b3ed-0c3c-496c-ab97-ea312cf878db", + "c211d274-6cf8-4f37-a201-1441b3f3c716" + ] + } + }, + { + "model": "runner.port", + "pk": "1b99610f-fb5e-44e3-ae0d-06935ec428f3", + "fields": { + "created_date": "2019-12-11T22:53:17.952Z", + "modified_date": "2020-02-04T15:29:59.195Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "conpair_pileups", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 55203868, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_P001_d.rg.md.pileup", + "checksum": "sha1$611ccefbf82e2cc1414acd833fcf7252483d1241", + "location": "bid://8b2f58fc-ff9a-4d00-a3e2-c62228b99993", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 33915095, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_N001_d.rg.md.pileup", + "checksum": "sha1$3dacd4c14bd6a19468145e911e58e7a258199d4b", + "location": "bid://995ae979-5156-4107-a9e6-20ce77f59ecb", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 55203868, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_P001_d.rg.md.pileup", + "checksum": "sha1$611ccefbf82e2cc1414acd833fcf7252483d1241", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.pileup", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 33915095, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_N001_d.rg.md.pileup", + "checksum": "sha1$3dacd4c14bd6a19468145e911e58e7a258199d4b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.pileup", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "8b2f58fc-ff9a-4d00-a3e2-c62228b99993", + "995ae979-5156-4107-a9e6-20ce77f59ecb" + ] + } + }, + { + "model": "runner.port", + "pk": "5dfbdb99-c066-4367-88fb-61b4a36ec862", + "fields": { + "created_date": "2019-12-11T22:53:17.982Z", + "modified_date": "2020-02-04T15:29:59.199Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "mutect_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 129554, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$a8f6c855b471bcf37a456ad441f72c8cf1b43be9", + "location": "bid://7ba48896-0c1a-443e-8258-0a35914dfd3e", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 32515, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e4a5c3663691f31da1bba6352dc16e35f3a8a197", + "location": "bid://18c3cd81-baa9-4e25-8616-743956972e25", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "value": { + "size": 129554, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$a8f6c855b471bcf37a456ad441f72c8cf1b43be9", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 32515, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e4a5c3663691f31da1bba6352dc16e35f3a8a197", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "7ba48896-0c1a-443e-8258-0a35914dfd3e" + ] + } + }, + { + "model": "runner.port", + "pk": "5a4cdbde-d41d-4028-9f11-803a998dd8dd", + "fields": { + "created_date": "2019-12-11T22:53:17.959Z", + "modified_date": "2020-02-04T15:29:59.203Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "mutect_callstats", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 172715192, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$7920889c2817038fb047c01d40187a083d928180", + "location": "bid://86a62cf2-398d-4876-b195-e2780ba594bd", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "value": { + "size": 172715192, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$7920889c2817038fb047c01d40187a083d928180", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "86a62cf2-398d-4876-b195-e2780ba594bd" + ] + } + }, + { + "model": "runner.port", + "pk": "a9207ba2-c6a9-43de-ad25-14079ec6f993", + "fields": { + "created_date": "2019-12-11T22:53:17.975Z", + "modified_date": "2020-02-04T15:29:59.212Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "vardict_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 13247144, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$d377fe9dea989c10fc9bff2a02f215ac75aec897", + "location": "bid://92c9dd48-f4de-4788-b7a3-fe9ff7d17d7b", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 429036, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e47841e84cd7b1c1ec384fa152d6ef4218b97704", + "location": "bid://9d092d5d-8b05-4a1b-bbc7-1238fb7b8eeb", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "value": { + "size": 13247144, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$d377fe9dea989c10fc9bff2a02f215ac75aec897", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 429036, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e47841e84cd7b1c1ec384fa152d6ef4218b97704", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "92c9dd48-f4de-4788-b7a3-fe9ff7d17d7b" + ] + } + }, + { + "model": "runner.port", + "pk": "16797b9c-6441-40af-bc6f-a422e6ee1d6b", + "fields": { + "created_date": "2019-12-11T22:53:17.990Z", + "modified_date": "2020-02-04T15:29:59.216Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_txt_hisens", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 11388, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$e7474ae2f7a0479c54d379f089ac0b823ac06c2a", + "location": "bid://b16cea6f-7590-4a4f-9be2-38e045bf60cf", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf" + }, + "value": { + "size": 11388, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$e7474ae2f7a0479c54d379f089ac0b823ac06c2a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf" + }, + "files": [ + "b16cea6f-7590-4a4f-9be2-38e045bf60cf" + ] + } + }, + { + "model": "runner.port", + "pk": "08b3287d-5e5f-4517-a3de-3d12bee361d0", + "fields": { + "created_date": "2019-12-11T22:53:17.993Z", + "modified_date": "2020-02-04T15:29:59.220Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "facets_txt_purity", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 7525, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$0b46c330b744e3ef85d1f9c5ed585ee348cd6480", + "location": "bid://3a95e8f1-aa34-4f81-b77a-ab59307c1d5f", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf" + }, + "value": { + "size": 7525, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$0b46c330b744e3ef85d1f9c5ed585ee348cd6480", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf" + }, + "files": [ + "3a95e8f1-aa34-4f81-b77a-ab59307c1d5f" + ] + } + }, + { + "model": "runner.port", + "pk": "6526dc8e-00fb-467b-9dcd-c608673b03f9", + "fields": { + "created_date": "2019-12-11T22:53:17.925Z", + "modified_date": "2020-02-04T15:29:59.226Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "per_target_coverage", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 19302184, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "checksum": "sha1$b8a270c8a6c15845afd2f0b87c4f6d4318b0ded2", + "location": "bid://3f92509f-90a9-4de8-ad81-1d021607918b", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 19114455, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "checksum": "sha1$63c8d87423a1c41b71e4347cf19ab6cb63285d94", + "location": "bid://afe65a89-6272-4276-bb34-d401f41a480a", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 19302184, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "checksum": "sha1$b8a270c8a6c15845afd2f0b87c4f6d4318b0ded2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.hstmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 19114455, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "checksum": "sha1$63c8d87423a1c41b71e4347cf19ab6cb63285d94", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.hstmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "3f92509f-90a9-4de8-ad81-1d021607918b", + "afe65a89-6272-4276-bb34-d401f41a480a" + ] + } + }, + { + "model": "runner.port", + "pk": "51a1c390-195d-419b-8a6e-84a7879857a1", + "fields": { + "created_date": "2019-12-11T22:53:18.011Z", + "modified_date": "2020-02-04T15:29:59.230Z", + "run": "ca18b090-03ad-4bef-acd3-52600f8e62eb", + "name": "merged_file_unfiltered", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 2741838, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "checksum": "sha1$12f83bbc5e86c8dce79eeb145535f0c91e6ac6fb", + "location": "bid://daef2d43-6a6f-4c3c-9e80-076e3e8288cb", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs" + }, + "value": { + "size": 2741838, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "checksum": "sha1$12f83bbc5e86c8dce79eeb145535f0c91e6ac6fb", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs" + }, + "files": [ + "daef2d43-6a6f-4c3c-9e80-076e3e8288cb" + ] + } + }, + { + "model": "file_system.file", + "pk": "914dce04-bc41-427e-9b6c-3084bfa61250", + "fields": { + "created_date": "2019-12-09T23:37:00.416Z", + "modified_date": "2019-12-09T23:37:00.416Z", + "file_name": "dbsnp_138.b37.excluding_sites_after_129.vcf", + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf", + "file_type": 11, + "size": 2432705678, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c868b6e9-92bd-4855-9726-7945e4471973", + "fields": { + "created_date": "2019-12-10T15:40:05.224Z", + "modified_date": "2019-12-10T15:40:05.224Z", + "file_name": "Mills_and_1000G_gold_standard.indels.b37.vcf", + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf", + "file_type": 11, + "size": 86369975, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "6f644f7f-a7b7-4573-a40a-6c5838f58b75", + "fields": { + "created_date": "2019-12-10T15:41:25.361Z", + "modified_date": "2019-12-10T15:41:25.361Z", + "file_name": "1000G_phase1.snps.high_confidence.b37.vcf", + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf", + "file_type": 11, + "size": 7313069069, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "100204c9-c560-43d9-ab4d-8c03bc207f4e", + "fields": { + "created_date": "2019-12-10T15:41:47.402Z", + "modified_date": "2019-12-10T15:41:47.402Z", + "file_name": "CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "file_type": 11, + "size": 112402812, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2", + "fields": { + "created_date": "2019-12-10T15:42:27.587Z", + "modified_date": "2019-12-10T15:42:27.587Z", + "file_name": "ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "file_type": 11, + "size": 337197976, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "fields": { + "created_date": "2019-10-24T00:23:15.075Z", + "modified_date": "2019-10-24T00:23:15.075Z", + "file_name": "refGene_b37.sorted.txt", + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.txt", + "file_type": 10, + "size": 9953757, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "584079c8-13af-4816-9ad3-50ce86e13934", + "fields": { + "created_date": "2019-10-24T00:23:17.243Z", + "modified_date": "2019-10-24T00:23:17.243Z", + "file_name": "dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "file_type": 11, + "size": 1015019014, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "1edc9e89-8014-406f-92ee-74084eb981cd", + "fields": { + "created_date": "2019-10-24T00:23:22.167Z", + "modified_date": "2019-10-24T00:23:22.167Z", + "file_name": "FP_tiling_genotypes.txt", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.txt", + "file_type": 10, + "size": 38179, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b7c7d59f-73a4-4968-bbf5-cd6aed491b91", + "fields": { + "created_date": "2019-10-24T00:23:22.408Z", + "modified_date": "2019-10-24T00:23:22.408Z", + "file_name": "FP_tiling_intervals.intervals", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_intervals.intervals", + "file_type": 7, + "size": 50804, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd", + "fields": { + "created_date": "2019-10-24T00:23:16.737Z", + "modified_date": "2019-10-24T00:23:16.737Z", + "file_name": "human.hg19.excl.tsv", + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.tsv", + "file_type": 9, + "size": 6984, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "a88b6dca-0601-4383-947f-27dbe8b83213", + "fields": { + "created_date": "2019-10-24T00:23:22.884Z", + "modified_date": "2019-10-24T00:23:22.884Z", + "file_name": "IDT_Exome_v1_FP_b37_baits.ilist", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_baits.ilist", + "file_type": 7, + "size": 7083292, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "92bff766-15fd-4316-8977-77afcef97dae", + "fields": { + "created_date": "2019-12-09T23:31:22.151Z", + "modified_date": "2019-12-09T23:31:22.151Z", + "file_name": "hotspot-list-union-v1-v2.maf", + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf", + "file_type": 24, + "size": 624846, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c29140df-2bdf-4553-ba5d-b0bf07fb347e", + "fields": { + "created_date": "2019-10-24T00:23:23.578Z", + "modified_date": "2019-10-24T00:23:23.578Z", + "file_name": "IDT_Exome_v1_FP_b37_targets.ilist", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_targets.ilist", + "file_type": 7, + "size": 6997415, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "a0fa83e4-8f43-44ba-8dce-719c18bc33b9", + "fields": { + "created_date": "2019-10-24T00:24:03.054Z", + "modified_date": "2019-10-24T00:24:03.054Z", + "file_name": "s_C_006284_N002_d.Group3.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006284_N002_d.Group3.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18001309333, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "1560276d-5d60-4bbf-bb16-2893fa5ec1b6", + "fields": { + "created_date": "2019-10-24T00:24:03.293Z", + "modified_date": "2019-10-24T00:24:03.293Z", + "file_name": "s_C_006537_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006537_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 13424642344, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "00e929a4-6ef8-46ca-ae7c-47fded158cbb", + "fields": { + "created_date": "2019-10-24T00:24:03.625Z", + "modified_date": "2019-10-24T00:24:03.625Z", + "file_name": "s_C_006550_N002_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006550_N002_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 13851651891, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "16aecbf7-94d8-4057-b6d0-409cf2d30f44", + "fields": { + "created_date": "2019-10-24T00:24:03.884Z", + "modified_date": "2019-10-24T00:24:03.884Z", + "file_name": "s_C_006609_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006609_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 16764556278, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "404e0dfd-b8c3-4c98-b07a-beadb4887939", + "fields": { + "created_date": "2019-10-24T00:24:04.123Z", + "modified_date": "2019-10-24T00:24:04.123Z", + "file_name": "s_C_006610_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006610_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17797687748, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e8dd7bdf-abfb-45e2-afd5-452ca86deb9d", + "fields": { + "created_date": "2019-10-24T00:24:04.371Z", + "modified_date": "2019-10-24T00:24:04.371Z", + "file_name": "s_C_006626_N001_d.Group19.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006626_N001_d.Group19.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 15450048427, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "07f85933-01ac-42f4-8c94-f751318e7376", + "fields": { + "created_date": "2019-10-24T00:24:04.617Z", + "modified_date": "2019-10-24T00:24:04.617Z", + "file_name": "s_C_006627_N001_d.Group20.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006627_N001_d.Group20.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 21418934197, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "0d64fb11-bc41-4963-9559-158411f15ce6", + "fields": { + "created_date": "2019-10-24T00:24:04.857Z", + "modified_date": "2019-10-24T00:24:04.857Z", + "file_name": "s_C_006628_N001_d.Group15.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006628_N001_d.Group15.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 20242506560, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "777be3e6-1cd5-4aef-a83d-db7061a11045", + "fields": { + "created_date": "2019-10-24T00:24:05.103Z", + "modified_date": "2019-10-24T00:24:05.103Z", + "file_name": "s_C_006630_N001_d.Group14.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006630_N001_d.Group14.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18554952981, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "62373f4a-efc1-4ae7-8252-e5d4a91218ba", + "fields": { + "created_date": "2019-10-24T00:24:05.351Z", + "modified_date": "2019-10-24T00:24:05.351Z", + "file_name": "s_C_006631_N001_d.Group17.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006631_N001_d.Group17.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17671380235, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "12ac7fba-2cbc-4ab5-b4c3-1fa44fc41e3e", + "fields": { + "created_date": "2019-10-24T00:24:05.592Z", + "modified_date": "2019-10-24T00:24:05.592Z", + "file_name": "s_C_006632_N001_d.Group16.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006632_N001_d.Group16.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17956822592, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b8f0c91b-9741-48dc-a617-7e4713819dc3", + "fields": { + "created_date": "2019-10-24T00:24:05.836Z", + "modified_date": "2019-10-24T00:24:05.836Z", + "file_name": "s_C_006633_N001_d.Group13.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006633_N001_d.Group13.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 14995930592, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f05da7bc-d9ca-4a93-929f-4d52a09c19aa", + "fields": { + "created_date": "2019-10-24T00:24:06.083Z", + "modified_date": "2019-10-24T00:24:06.083Z", + "file_name": "s_C_006635_N001_d.Group8.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006635_N001_d.Group8.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19452196435, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "d85ba214-e41d-4c0b-a7fd-d0c3cff0b052", + "fields": { + "created_date": "2019-10-24T00:24:06.409Z", + "modified_date": "2019-10-24T00:24:06.409Z", + "file_name": "s_C_006636_N001_d.Group9.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006636_N001_d.Group9.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19189450319, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "45316ece-3691-4b9c-b636-3e02594580cf", + "fields": { + "created_date": "2019-10-24T00:24:06.658Z", + "modified_date": "2019-10-24T00:24:06.658Z", + "file_name": "s_C_006637_N002_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006637_N002_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 10888838079, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "aa352bb2-7209-4f14-9750-12e6c4f296ab", + "fields": { + "created_date": "2019-10-24T00:24:06.901Z", + "modified_date": "2019-10-24T00:24:06.901Z", + "file_name": "s_C_006638_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006638_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 10088003650, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "cc9c56f9-0432-4058-aec9-f61207718feb", + "fields": { + "created_date": "2019-10-24T00:24:07.146Z", + "modified_date": "2019-10-24T00:24:07.146Z", + "file_name": "s_C_006639_N001_d.Group6.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006639_N001_d.Group6.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18437335538, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b973583f-e8fd-4156-af89-852747dbce51", + "fields": { + "created_date": "2019-10-24T00:24:07.394Z", + "modified_date": "2019-10-24T00:24:07.394Z", + "file_name": "s_C_006640_N001_d.Group7.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006640_N001_d.Group7.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18781758639, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "0978e54d-5f7e-4383-abcb-2cb675659c6b", + "fields": { + "created_date": "2019-10-24T00:24:07.716Z", + "modified_date": "2019-10-24T00:24:07.716Z", + "file_name": "s_C_006641_N001_d.Group4.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006641_N001_d.Group4.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 15954753147, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "cd114cae-5147-40a4-907f-82567b31bcc4", + "fields": { + "created_date": "2019-10-24T00:24:07.979Z", + "modified_date": "2019-10-24T00:24:07.979Z", + "file_name": "s_C_006642_N001_d.Group5.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006642_N001_d.Group5.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17579506808, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8eaf9fc4-c0fd-4d04-940d-754eac5f429e", + "fields": { + "created_date": "2019-10-24T00:24:08.240Z", + "modified_date": "2019-10-24T00:24:08.240Z", + "file_name": "s_C_006643_N001_d.Group2.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006643_N001_d.Group2.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17298827865, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b4583b1b-d570-4f92-a8f1-95a036c239f6", + "fields": { + "created_date": "2019-10-24T00:24:08.520Z", + "modified_date": "2019-10-24T00:24:08.520Z", + "file_name": "s_C_006644_N001_d.Group3.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006644_N001_d.Group3.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19302206744, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b1f6d1fd-163d-4616-8d15-67f888216e93", + "fields": { + "created_date": "2019-10-24T00:24:08.779Z", + "modified_date": "2019-10-24T00:24:08.779Z", + "file_name": "s_C_006645_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006645_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 15523622669, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "1998b585-d331-449b-b963-a8e42d64ec4b", + "fields": { + "created_date": "2019-10-24T00:24:09.034Z", + "modified_date": "2019-10-24T00:24:09.034Z", + "file_name": "s_C_006646_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006646_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17007314582, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8ad44576-6f3c-443d-84f2-71790469ce60", + "fields": { + "created_date": "2019-10-24T00:24:09.280Z", + "modified_date": "2019-10-24T00:24:09.281Z", + "file_name": "s_C_006647_N001_d.Group18.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006647_N001_d.Group18.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 20776680414, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b89ed0be-70c6-4452-b98c-a6577ac07421", + "fields": { + "created_date": "2019-10-24T00:24:09.521Z", + "modified_date": "2019-10-24T00:24:09.521Z", + "file_name": "s_C_006648_N001_d.Group11.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006648_N001_d.Group11.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17232710261, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "fdc12b20-3121-4176-afda-a161de7e5834", + "fields": { + "created_date": "2019-10-24T00:24:09.769Z", + "modified_date": "2019-10-24T00:24:09.769Z", + "file_name": "s_C_006649_N001_d.Group10.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006649_N001_d.Group10.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17366153538, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dd0a5f64-011c-4461-963e-ba85d529a2dd", + "fields": { + "created_date": "2019-10-24T00:24:10.024Z", + "modified_date": "2019-10-24T00:24:10.024Z", + "file_name": "s_C_006650_N001_d.Group21.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006650_N001_d.Group21.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 16571180154, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "507e913b-66fe-43a8-bbef-da9944556898", + "fields": { + "created_date": "2019-10-24T00:24:10.268Z", + "modified_date": "2019-10-24T00:24:10.268Z", + "file_name": "s_C_006904_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006904_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18185638557, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "df51e7ab-0582-4e3b-9242-a95f0ba0fde8", + "fields": { + "created_date": "2019-10-24T00:24:10.512Z", + "modified_date": "2019-10-24T00:24:10.512Z", + "file_name": "s_C_006905_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006905_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18558003865, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f363912b-96b1-4898-94fb-025bd9e4d859", + "fields": { + "created_date": "2019-10-24T00:24:10.758Z", + "modified_date": "2019-10-24T00:24:10.758Z", + "file_name": "s_C_006906_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006906_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 16951748171, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8808aeca-3a6d-478d-b4b5-a4818d624271", + "fields": { + "created_date": "2019-10-24T00:24:10.995Z", + "modified_date": "2019-10-24T00:24:10.995Z", + "file_name": "s_C_006907_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006907_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 16389279357, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "754edfb4-83bc-466f-99b3-c8d29f3bacd9", + "fields": { + "created_date": "2019-10-24T00:24:11.235Z", + "modified_date": "2019-10-24T00:24:11.235Z", + "file_name": "s_C_006996_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006996_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 10690676737, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "0eb765d1-797f-482e-ab3f-a5ec90416ec8", + "fields": { + "created_date": "2019-10-24T00:24:11.482Z", + "modified_date": "2019-10-24T00:24:11.482Z", + "file_name": "s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 13862649385, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "7afbce7f-0ae7-4120-8711-15de848a2bde", + "fields": { + "created_date": "2019-10-24T00:24:11.720Z", + "modified_date": "2019-10-24T00:24:11.720Z", + "file_name": "s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 11105358516, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "a3ef2b60-a2e3-40ee-b06a-d2c1580aaad2", + "fields": { + "created_date": "2019-10-24T00:24:11.963Z", + "modified_date": "2019-10-24T00:24:11.963Z", + "file_name": "s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 17582103301, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e5f5ce8a-16e3-4310-afed-1e846bb4696b", + "fields": { + "created_date": "2019-10-24T00:24:12.210Z", + "modified_date": "2019-10-24T00:24:12.210Z", + "file_name": "s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19349236927, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "91770ec9-d82c-45b2-9ce7-da18b67cb4c0", + "fields": { + "created_date": "2019-10-24T00:24:12.513Z", + "modified_date": "2019-10-24T00:24:12.513Z", + "file_name": "s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 20668078544, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c5b27f38-4d0f-4fda-bf2d-c3c72fbbc3cf", + "fields": { + "created_date": "2019-10-24T00:24:12.759Z", + "modified_date": "2019-10-24T00:24:12.759Z", + "file_name": "s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 18873117772, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "316a84f9-1e44-4294-acd9-44007db6fa9d", + "fields": { + "created_date": "2019-12-06T20:06:03.478Z", + "modified_date": "2019-12-06T20:06:03.478Z", + "file_name": "s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 19501528278, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "96e3a791-2bc7-45f8-acc6-e519a29d5d0b", + "fields": { + "created_date": "2019-12-06T20:05:01.506Z", + "modified_date": "2019-12-06T20:05:01.506Z", + "file_name": "b37.fasta", + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta", + "file_type": 2, + "size": 3189750467, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7", + "fields": { + "created_date": "2019-10-24T00:23:19.218Z", + "modified_date": "2019-10-24T00:23:19.218Z", + "file_name": "GRCm38.fasta", + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta", + "file_type": 2, + "size": 2769885087, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "87b6a57c-f15b-49eb-9d22-d3893d2e00ef", + "fields": { + "created_date": "2019-12-09T23:34:12.885Z", + "modified_date": "2019-12-09T23:34:12.886Z", + "file_name": "hapmap_3.3.b37.vcf", + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf", + "file_type": 11, + "size": 225898391, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "242cebfb-2b22-4e69-9cbf-478c4f026c3d", + "fields": { + "created_date": "2019-11-29T21:15:53.295Z", + "modified_date": "2020-02-03T22:05:10.092Z", + "file_name": "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz", + "file_type": 1, + "size": 5966546453, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "02cfb077-f61c-4659-9877-752c456e8f80", + "fields": { + "created_date": "2019-11-29T21:15:53.254Z", + "modified_date": "2020-02-03T22:05:10.069Z", + "file_name": "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz", + "file_type": 1, + "size": 5832468368, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "d320fc3a-07e6-46c6-88f4-ad6480cf446e", + "fields": { + "created_date": "2019-11-29T21:15:51.010Z", + "modified_date": "2020-02-03T22:05:10.138Z", + "file_name": "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz", + "file_type": 1, + "size": 3576965127, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "47be3848-e16b-4126-9e64-1d3f5a67b927", + "fields": { + "created_date": "2019-11-29T21:15:50.983Z", + "modified_date": "2020-02-03T22:05:10.112Z", + "file_name": "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz", + "file_type": 1, + "size": 3592299152, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ad10ee7-c875-46cb-9a69-57acd461cf41", + "fields": { + "created_date": "2019-12-09T23:37:00.429Z", + "modified_date": "2019-12-09T23:37:00.429Z", + "file": "914dce04-bc41-427e-9b6c-3084bfa61250", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ae8c6fe5-f9e3-4650-9f09-8906342e4783", + "fields": { + "created_date": "2019-12-10T15:40:05.251Z", + "modified_date": "2019-12-10T15:40:05.251Z", + "file": "c868b6e9-92bd-4855-9726-7945e4471973", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "abfd67dc-9139-4165-aa46-de34de1903d6", + "fields": { + "created_date": "2019-12-10T15:41:25.375Z", + "modified_date": "2019-12-10T15:41:25.375Z", + "file": "6f644f7f-a7b7-4573-a40a-6c5838f58b75", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "de7089b7-8a69-4948-b601-5b965e4e9dae", + "fields": { + "created_date": "2019-12-10T15:41:47.412Z", + "modified_date": "2019-12-10T15:41:47.412Z", + "file": "100204c9-c560-43d9-ab4d-8c03bc207f4e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "300442b0-9009-4d2c-9dc1-c226a7c09ee8", + "fields": { + "created_date": "2019-12-10T15:42:27.601Z", + "modified_date": "2019-12-10T15:42:27.601Z", + "file": "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "10454e5e-9a20-4beb-af95-fcf2d856ecaf", + "fields": { + "created_date": "2019-10-24T00:23:15.094Z", + "modified_date": "2019-10-24T00:23:15.094Z", + "file": "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "refseq" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d386a959-9036-4eaf-8793-4ee7aaff0c07", + "fields": { + "created_date": "2019-10-24T00:23:17.253Z", + "modified_date": "2019-10-24T00:23:17.253Z", + "file": "584079c8-13af-4816-9ad3-50ce86e13934", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "facets_snps" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0d21e695-1518-430b-833a-4287bd8b4823", + "fields": { + "created_date": "2019-10-24T00:23:22.177Z", + "modified_date": "2019-10-24T00:23:22.177Z", + "file": "1edc9e89-8014-406f-92ee-74084eb981cd", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "FP_genotypes" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "85784758-ab15-4e0d-9ec7-285b63fb29e1", + "fields": { + "created_date": "2019-10-24T00:23:22.418Z", + "modified_date": "2019-10-24T00:23:22.418Z", + "file": "b7c7d59f-73a4-4968-bbf5-cd6aed491b91", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "FP_intervals" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c572a28f-c8a7-4fae-b6a5-b1de88f49eda", + "fields": { + "created_date": "2019-10-24T00:23:16.747Z", + "modified_date": "2019-10-24T00:23:16.747Z", + "file": "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "delly" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f275945d-81d3-4790-9dca-90f665a97041", + "fields": { + "created_date": "2019-10-24T00:23:22.894Z", + "modified_date": "2019-10-24T00:23:22.894Z", + "file": "a88b6dca-0601-4383-947f-27dbe8b83213", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "baits_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d82d6bf2-1014-47b5-9475-95ad04a3c729", + "fields": { + "created_date": "2019-12-09T23:31:22.187Z", + "modified_date": "2019-12-09T23:31:22.187Z", + "file": "92bff766-15fd-4316-8977-77afcef97dae", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ec0f3369-0dec-4a35-9cff-f7e1e95834e7", + "fields": { + "created_date": "2019-10-24T00:23:23.589Z", + "modified_date": "2019-10-24T00:23:23.589Z", + "file": "c29140df-2bdf-4553-ba5d-b0bf07fb347e", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "targets_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c96af6d8-1320-49a2-93b5-d90c87f581d9", + "fields": { + "created_date": "2019-10-24T00:24:03.064Z", + "modified_date": "2019-10-24T00:24:03.064Z", + "file": "a0fa83e4-8f43-44ba-8dce-719c18bc33b9", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9a040d42-11df-4105-88ac-5bc20a8e82f2", + "fields": { + "created_date": "2019-10-24T00:24:03.303Z", + "modified_date": "2019-10-24T00:24:03.303Z", + "file": "1560276d-5d60-4bbf-bb16-2893fa5ec1b6", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8b76946d-15c6-49b4-ba6b-9f970666a5ef", + "fields": { + "created_date": "2019-10-24T00:24:03.636Z", + "modified_date": "2019-10-24T00:24:03.636Z", + "file": "00e929a4-6ef8-46ca-ae7c-47fded158cbb", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "96e9bc30-a8d0-4627-b9f1-8c0dd6611db6", + "fields": { + "created_date": "2019-10-24T00:24:03.895Z", + "modified_date": "2019-10-24T00:24:03.895Z", + "file": "16aecbf7-94d8-4057-b6d0-409cf2d30f44", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "eda44586-5ca2-4c1d-904e-327211bb64ee", + "fields": { + "created_date": "2019-10-24T00:24:04.133Z", + "modified_date": "2019-10-24T00:24:04.133Z", + "file": "404e0dfd-b8c3-4c98-b07a-beadb4887939", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "64b8c142-f933-4ad5-8cf9-2960b02bdf7b", + "fields": { + "created_date": "2019-10-24T00:24:04.381Z", + "modified_date": "2019-10-24T00:24:04.381Z", + "file": "e8dd7bdf-abfb-45e2-afd5-452ca86deb9d", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1a62e03c-7225-4786-a67f-fff159ec4711", + "fields": { + "created_date": "2019-10-24T00:24:04.627Z", + "modified_date": "2019-10-24T00:24:04.627Z", + "file": "07f85933-01ac-42f4-8c94-f751318e7376", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b539ca59-25f3-45cc-991f-fc87b7378cd5", + "fields": { + "created_date": "2019-10-24T00:24:04.868Z", + "modified_date": "2019-10-24T00:24:04.868Z", + "file": "0d64fb11-bc41-4963-9559-158411f15ce6", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e8add0c9-e115-4bab-980d-ffa0cfcb667a", + "fields": { + "created_date": "2019-10-24T00:24:05.113Z", + "modified_date": "2019-10-24T00:24:05.113Z", + "file": "777be3e6-1cd5-4aef-a83d-db7061a11045", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "66ebd65b-87d2-42ea-8e15-594182394412", + "fields": { + "created_date": "2019-10-24T00:24:05.361Z", + "modified_date": "2019-10-24T00:24:05.361Z", + "file": "62373f4a-efc1-4ae7-8252-e5d4a91218ba", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "059139ea-63c6-4673-9d0d-c51cf76a0001", + "fields": { + "created_date": "2019-10-24T00:24:05.600Z", + "modified_date": "2019-10-24T00:24:05.601Z", + "file": "12ac7fba-2cbc-4ab5-b4c3-1fa44fc41e3e", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "adc259a3-e3d0-4b3f-b7b2-4abd57794152", + "fields": { + "created_date": "2019-10-24T00:24:05.847Z", + "modified_date": "2019-10-24T00:24:05.847Z", + "file": "b8f0c91b-9741-48dc-a617-7e4713819dc3", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "69339850-3a8a-403d-ba03-45d256304fbc", + "fields": { + "created_date": "2019-10-24T00:24:06.093Z", + "modified_date": "2019-10-24T00:24:06.093Z", + "file": "f05da7bc-d9ca-4a93-929f-4d52a09c19aa", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a795bdc0-2cf1-4a37-88de-e8d93df9f90c", + "fields": { + "created_date": "2019-10-24T00:24:06.419Z", + "modified_date": "2019-10-24T00:24:06.419Z", + "file": "d85ba214-e41d-4c0b-a7fd-d0c3cff0b052", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8ea26aab-b30f-416c-8949-4d65726b42ad", + "fields": { + "created_date": "2019-10-24T00:24:06.667Z", + "modified_date": "2019-10-24T00:24:06.667Z", + "file": "45316ece-3691-4b9c-b636-3e02594580cf", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fa32607e-faef-4e10-be2c-5252e1aa10f1", + "fields": { + "created_date": "2019-10-24T00:24:06.911Z", + "modified_date": "2019-10-24T00:24:06.911Z", + "file": "aa352bb2-7209-4f14-9750-12e6c4f296ab", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "67e166d4-fcf2-42a4-b42a-09611ea19bf5", + "fields": { + "created_date": "2019-10-24T00:24:07.160Z", + "modified_date": "2019-10-24T00:24:07.160Z", + "file": "cc9c56f9-0432-4058-aec9-f61207718feb", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8e8dbab1-ca4e-42f5-9209-fbcb812cc367", + "fields": { + "created_date": "2019-10-24T00:24:07.404Z", + "modified_date": "2019-10-24T00:24:07.404Z", + "file": "b973583f-e8fd-4156-af89-852747dbce51", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e779ddb7-b090-40f7-8647-52a82819df74", + "fields": { + "created_date": "2019-10-24T00:24:07.725Z", + "modified_date": "2019-10-24T00:24:07.725Z", + "file": "0978e54d-5f7e-4383-abcb-2cb675659c6b", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "393564d7-931d-4baf-9b7c-9d013b0ccb5d", + "fields": { + "created_date": "2019-10-24T00:24:07.989Z", + "modified_date": "2019-10-24T00:24:07.989Z", + "file": "cd114cae-5147-40a4-907f-82567b31bcc4", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f068eaa1-edb0-4486-b715-cc6b37e34325", + "fields": { + "created_date": "2019-10-24T00:24:08.249Z", + "modified_date": "2019-10-24T00:24:08.249Z", + "file": "8eaf9fc4-c0fd-4d04-940d-754eac5f429e", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "73e82d33-aa7a-45dd-bd0f-29be4be714a1", + "fields": { + "created_date": "2019-10-24T00:24:08.532Z", + "modified_date": "2019-10-24T00:24:08.532Z", + "file": "b4583b1b-d570-4f92-a8f1-95a036c239f6", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ce087f33-c593-47ab-b450-f088bc7ee005", + "fields": { + "created_date": "2019-10-24T00:24:08.789Z", + "modified_date": "2019-10-24T00:24:08.789Z", + "file": "b1f6d1fd-163d-4616-8d15-67f888216e93", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b1fe6c80-ae66-4ade-ad0f-51525b9d629d", + "fields": { + "created_date": "2019-10-24T00:24:09.045Z", + "modified_date": "2019-10-24T00:24:09.046Z", + "file": "1998b585-d331-449b-b963-a8e42d64ec4b", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a530f4ad-fc3e-4128-b39c-d660bf8885f5", + "fields": { + "created_date": "2019-10-24T00:24:09.290Z", + "modified_date": "2019-10-24T00:24:09.290Z", + "file": "8ad44576-6f3c-443d-84f2-71790469ce60", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "af440113-a72d-4862-b47b-8d141389ac45", + "fields": { + "created_date": "2019-10-24T00:24:09.530Z", + "modified_date": "2019-10-24T00:24:09.530Z", + "file": "b89ed0be-70c6-4452-b98c-a6577ac07421", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6e6de7f4-74ec-4f08-9798-abdee1c6617c", + "fields": { + "created_date": "2019-10-24T00:24:09.779Z", + "modified_date": "2019-10-24T00:24:09.779Z", + "file": "fdc12b20-3121-4176-afda-a161de7e5834", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4d364c04-9c5b-4780-ab28-b7127d7df444", + "fields": { + "created_date": "2019-10-24T00:24:10.035Z", + "modified_date": "2019-10-24T00:24:10.035Z", + "file": "dd0a5f64-011c-4461-963e-ba85d529a2dd", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "48d0a5b9-c412-4b74-ab37-5732c5289eea", + "fields": { + "created_date": "2019-10-24T00:24:10.278Z", + "modified_date": "2019-10-24T00:24:10.278Z", + "file": "507e913b-66fe-43a8-bbef-da9944556898", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "412085e9-e5c5-4236-9811-c0bb2862c4b8", + "fields": { + "created_date": "2019-10-24T00:24:10.522Z", + "modified_date": "2019-10-24T00:24:10.522Z", + "file": "df51e7ab-0582-4e3b-9242-a95f0ba0fde8", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2a17b794-572e-45be-9048-0b3fb2c47dd7", + "fields": { + "created_date": "2019-10-24T00:24:10.768Z", + "modified_date": "2019-10-24T00:24:10.768Z", + "file": "f363912b-96b1-4898-94fb-025bd9e4d859", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a313383f-9605-436c-b8c0-4480262723fe", + "fields": { + "created_date": "2019-10-24T00:24:11.005Z", + "modified_date": "2019-10-24T00:24:11.005Z", + "file": "8808aeca-3a6d-478d-b4b5-a4818d624271", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ab8f54ad-a962-4ebe-a03e-5aa50bc6c047", + "fields": { + "created_date": "2019-10-24T00:24:11.244Z", + "modified_date": "2019-10-24T00:24:11.244Z", + "file": "754edfb4-83bc-466f-99b3-c8d29f3bacd9", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d0669bc4-3afc-4b0e-9900-dc7774a32d70", + "fields": { + "created_date": "2019-10-24T00:24:11.492Z", + "modified_date": "2019-10-24T00:24:11.492Z", + "file": "0eb765d1-797f-482e-ab3f-a5ec90416ec8", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "edbe8dbe-e622-4095-bcd2-05792ea6b498", + "fields": { + "created_date": "2019-10-24T00:24:11.730Z", + "modified_date": "2019-10-24T00:24:11.731Z", + "file": "7afbce7f-0ae7-4120-8711-15de848a2bde", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3e47586d-0a03-4d05-b174-6196ebbd28d4", + "fields": { + "created_date": "2019-10-24T00:24:11.974Z", + "modified_date": "2019-10-24T00:24:11.974Z", + "file": "a3ef2b60-a2e3-40ee-b06a-d2c1580aaad2", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c4c158b1-3535-4847-8ada-2178a6558956", + "fields": { + "created_date": "2019-10-24T00:24:12.219Z", + "modified_date": "2019-10-24T00:24:12.219Z", + "file": "e5f5ce8a-16e3-4310-afed-1e846bb4696b", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3feb253c-be4b-4357-b7f2-958ae64cced0", + "fields": { + "created_date": "2019-10-24T00:24:12.525Z", + "modified_date": "2019-10-24T00:24:12.525Z", + "file": "91770ec9-d82c-45b2-9ce7-da18b67cb4c0", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "215f0a3b-ca9e-4786-9426-ca3f6eb79d5a", + "fields": { + "created_date": "2019-10-24T00:24:12.769Z", + "modified_date": "2019-10-24T00:24:12.769Z", + "file": "c5b27f38-4d0f-4fda-bf2d-c3c72fbbc3cf", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "79a4b7e4-bf97-4672-9e22-44e859feda9e", + "fields": { + "created_date": "2019-12-06T20:06:03.487Z", + "modified_date": "2019-12-06T20:06:03.487Z", + "file": "316a84f9-1e44-4294-acd9-44007db6fa9d", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "61a79866-b376-47e4-9d2e-f48ba2db7eba", + "fields": { + "created_date": "2019-12-06T20:05:01.781Z", + "modified_date": "2019-12-06T20:05:01.781Z", + "file": "96e3a791-2bc7-45f8-acc6-e519a29d5d0b", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2257c5e7-356a-422e-b409-ecddac244f00", + "fields": { + "created_date": "2019-10-24T00:23:19.228Z", + "modified_date": "2019-10-24T00:23:19.228Z", + "file": "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7", + "version": 0, + "metadata": { + "genome": "GRCh38", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "25dc1fa1-b0d5-4924-9ccb-bb18ec59f4ac", + "fields": { + "created_date": "2019-12-09T23:34:12.902Z", + "modified_date": "2019-12-09T23:34:12.902Z", + "file": "87b6a57c-f15b-49eb-9d22-d3893d2e00ef", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ef7063a-3abc-4fe9-bee9-db2d39f6f084", + "fields": { + "created_date": "2020-02-03T22:05:10.089Z", + "modified_date": "2020-02-03T22:05:10.089Z", + "file": "242cebfb-2b22-4e69-9cbf-478c4f026c3d", + "version": 2, + "metadata": { + "R": "R1", + "sex": "M", + "runId": "PITT_0390", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-15", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_1", + "barcodeId": "IDT366", + "libraryId": null, + "patientId": "C-K2902H", + "requestId": "09670_D", + "flowCellId": "H7HCTBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-P001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Primary", + "barcodeIndex": "ACATACGG", + "labHeadEmail": "user@internet.com", + "oncoTreeCode": "DDLS", + "preservation": "Frozen", + "sampleOrigin": "Tissue", + "specimenType": "Biopsy", + "flowCellLanes": [ + 1, + 2, + 3, + 4, + 5, + 6 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "S16-68609", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "S16-68609", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 40.03237153464453 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "08beab48-57bc-41b1-9776-e0cb84949401", + "fields": { + "created_date": "2020-02-03T22:05:10.065Z", + "modified_date": "2020-02-03T22:05:10.065Z", + "file": "02cfb077-f61c-4659-9877-752c456e8f80", + "version": 2, + "metadata": { + "R": "R2", + "sex": "M", + "runId": "PITT_0390", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-15", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_1", + "barcodeId": "IDT366", + "libraryId": "09670_D_1_1_1_1_1", + "patientId": "C-K2902H", + "requestId": "09670_D", + "flowCellId": "H7HCTBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-P001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Primary", + "barcodeIndex": "ACATACGG", + "labHeadEmail": "user@internet.com", + "oncoTreeCode": "DDLS", + "preservation": "Frozen", + "sampleOrigin": "Tissue", + "specimenType": "Biopsy", + "flowCellLanes": [ + 1, + 2, + 3, + 4, + 5, + 6 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "S16-68609", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "S16-68609", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 40.03237153464453 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "705149b0-69c1-4672-b4e8-ed71a8eb5ebe", + "fields": { + "created_date": "2020-02-03T22:05:10.135Z", + "modified_date": "2020-02-03T22:05:10.136Z", + "file": "d320fc3a-07e6-46c6-88f4-ad6480cf446e", + "version": 2, + "metadata": { + "R": "R1", + "sex": "M", + "runId": "PITT_0391", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-19", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_46", + "barcodeId": null, + "libraryId": null, + "patientId": "C-K2902H", + "requestId": "09670_D", + "flowCellId": "H7FKJBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-N001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Normal", + "barcodeIndex": null, + "labHeadEmail": "user@internet.com", + "oncoTreeCode": null, + "preservation": "EDTA-Streck", + "sampleOrigin": "Whole Blood", + "specimenType": "Blood", + "flowCellLanes": [ + 5, + 6, + 7, + 8 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "P-0017035-N01-WES", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "P-0017035-N01-WES", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 32.135796910139796 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2d8b63f4-90ba-4fc0-8fc5-37be735b566a", + "fields": { + "created_date": "2020-02-03T22:05:10.109Z", + "modified_date": "2020-02-03T22:05:10.109Z", + "file": "47be3848-e16b-4126-9e64-1d3f5a67b927", + "version": 2, + "metadata": { + "R": "R2", + "sex": "M", + "runId": "PITT_0391", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-19", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_46", + "barcodeId": null, + "libraryId": "09670_D_46_1", + "patientId": "C-K2902H", + "requestId": "09670_D", + "flowCellId": "H7FKJBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-N001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Normal", + "barcodeIndex": null, + "labHeadEmail": "user@internet.com", + "oncoTreeCode": null, + "preservation": "EDTA-Streck", + "sampleOrigin": "Whole Blood", + "specimenType": "Blood", + "flowCellLanes": [ + 5, + 6, + 7, + 8 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "P-0017035-N01-WES", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "P-0017035-N01-WES", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 32.135796910139796 + }, + "user": null + } + }, + { + "model": "file_system.file", + "pk": "b835c33c-d241-42fc-beb2-e1ce1c41a77d", + "fields": { + "created_date": "2019-12-14T12:08:14.368Z", + "modified_date": "2019-12-14T12:08:14.368Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "file_type": 11, + "size": 65612975, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "f9f55509-fcae-45f7-bdd2-72aebb59178e", + "fields": { + "created_date": "2019-12-14T12:08:13.539Z", + "modified_date": "2019-12-14T12:08:13.539Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "file_type": 24, + "size": 181310718, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e528ce76-0c6f-4088-8e22-38ece693bcdd", + "fields": { + "created_date": "2019-12-14T12:08:13.575Z", + "modified_date": "2019-12-14T12:08:13.575Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 22899967017, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "f6d0fd8d-cae6-469d-ab57-f22ab55178c9", + "fields": { + "created_date": "2019-12-14T12:08:13.614Z", + "modified_date": "2019-12-14T12:08:13.614Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 14961505727, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "0f1e06cb-c77b-4988-994f-797eab18cbea", + "fields": { + "created_date": "2019-12-14T12:08:13.658Z", + "modified_date": "2019-12-14T12:08:13.658Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "file_type": 21, + "size": 2641, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "48dd6384-7034-4cc7-9027-7df71496eb27", + "fields": { + "created_date": "2019-12-14T12:08:13.676Z", + "modified_date": "2019-12-14T12:08:13.676Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "file_type": 21, + "size": 2611, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2c2b195f-514c-4107-af3a-8488cf6547ea", + "fields": { + "created_date": "2019-12-14T12:08:13.695Z", + "modified_date": "2019-12-14T12:08:13.695Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "file_type": 21, + "size": 2576, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2af79d18-4ba7-4aef-8505-bd775d47b00d", + "fields": { + "created_date": "2019-12-14T12:08:13.713Z", + "modified_date": "2019-12-14T12:08:13.713Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "file_type": 21, + "size": 2764, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2a1736ce-50fd-4721-92da-474f67318c8d", + "fields": { + "created_date": "2019-12-14T12:08:13.731Z", + "modified_date": "2019-12-14T12:08:13.731Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "file_type": 21, + "size": 2714, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e6d2247d-c056-467b-8ddb-6cf6e0387f26", + "fields": { + "created_date": "2019-12-14T12:08:13.754Z", + "modified_date": "2019-12-14T12:08:13.754Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "file_type": 21, + "size": 2818, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "aecc788a-ebd8-4e3d-bb25-6bc6a373f5fa", + "fields": { + "created_date": "2019-12-14T12:08:13.778Z", + "modified_date": "2019-12-14T12:08:13.778Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "file_type": 21, + "size": 2815, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e0ad9888-930b-4c87-9797-a5a88894cb2a", + "fields": { + "created_date": "2019-12-14T12:08:13.803Z", + "modified_date": "2019-12-14T12:08:13.803Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "file_type": 21, + "size": 2775, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "75f8f49a-ffe7-4cf4-8956-0adacfe9f6f6", + "fields": { + "created_date": "2019-12-14T12:08:13.820Z", + "modified_date": "2019-12-14T12:08:13.820Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "file_type": 21, + "size": 2873, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2a41fde8-172a-439c-8a9e-9681069c87fa", + "fields": { + "created_date": "2019-12-14T12:08:13.836Z", + "modified_date": "2019-12-14T12:08:13.836Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "file_type": 21, + "size": 2826, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "463c0311-e32f-40ae-a1a2-d831431997b7", + "fields": { + "created_date": "2019-12-14T12:08:13.858Z", + "modified_date": "2019-12-14T12:08:13.858Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "file_type": 24, + "size": 59073, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "0fdc6110-b18f-4ef0-9c50-9905bf4a22a9", + "fields": { + "created_date": "2019-12-14T12:08:13.880Z", + "modified_date": "2019-12-14T12:08:13.880Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "file_type": 21, + "size": 8189, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "9290ce2b-2dbd-4253-a4dd-9edf7fe79114", + "fields": { + "created_date": "2019-12-14T12:08:13.896Z", + "modified_date": "2019-12-14T12:08:13.896Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "file_type": 21, + "size": 8219, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b9cd207a-f8d5-4c41-8506-f8bb6b0f61af", + "fields": { + "created_date": "2019-12-14T12:08:13.930Z", + "modified_date": "2019-12-14T12:08:13.930Z", + "file_name": "s_C_K2902H_P001_d.rg.md.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.asmetrics", + "file_type": 21, + "size": 2171, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "22a814db-f3ad-4fb2-ae81-c56b41f01f13", + "fields": { + "created_date": "2019-12-14T12:08:13.947Z", + "modified_date": "2019-12-14T12:08:13.947Z", + "file_name": "s_C_K2902H_N001_d.rg.md.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.asmetrics", + "file_type": 21, + "size": 2134, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "48a16d33-0fd4-41df-9bca-fe87c15c119e", + "fields": { + "created_date": "2019-12-14T12:08:13.969Z", + "modified_date": "2019-12-14T12:08:13.969Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "file_type": 21, + "size": 603, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "734731f7-a505-4aaa-957e-ce706342f555", + "fields": { + "created_date": "2019-12-14T12:08:13.986Z", + "modified_date": "2019-12-14T12:08:13.986Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "file_type": 21, + "size": 602, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "a813b899-7525-480b-9a8d-fe844abf06cf", + "fields": { + "created_date": "2019-12-14T12:08:14.009Z", + "modified_date": "2019-12-14T12:08:14.009Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "file_type": 21, + "size": 124853, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "9cbfedb0-dac4-4151-ac25-2553fc46fad6", + "fields": { + "created_date": "2019-12-14T12:08:14.027Z", + "modified_date": "2019-12-14T12:08:14.027Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "file_type": 21, + "size": 111084, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1e25988d-2f5d-45bf-ab60-a3e8bf3b0811", + "fields": { + "created_date": "2019-12-14T12:08:14.050Z", + "modified_date": "2019-12-14T12:08:14.050Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "file_type": 21, + "size": 4777, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "97923d95-86f5-4f95-ab20-3cb7882b79cc", + "fields": { + "created_date": "2019-12-14T12:08:14.068Z", + "modified_date": "2019-12-14T12:08:14.068Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "file_type": 21, + "size": 3222, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "ad08e7ac-2877-41da-a16a-f468f3130158", + "fields": { + "created_date": "2019-12-14T12:08:14.092Z", + "modified_date": "2019-12-14T12:08:14.092Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "file_type": 21, + "size": 6784, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "7694cc12-25c1-4585-93ce-fa5c540b5f17", + "fields": { + "created_date": "2019-12-14T12:08:14.108Z", + "modified_date": "2019-12-14T12:08:14.108Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "file_type": 21, + "size": 6794, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "4d8d1cf0-fc62-4ed6-a0bd-0dfbef86b277", + "fields": { + "created_date": "2019-12-14T12:08:14.131Z", + "modified_date": "2019-12-14T12:08:14.131Z", + "file_name": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.hsmetrics", + "file_type": 21, + "size": 5016, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e4475a18-ce54-40c1-82cf-dd9323157658", + "fields": { + "created_date": "2019-12-14T12:08:14.147Z", + "modified_date": "2019-12-14T12:08:14.147Z", + "file_name": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.hsmetrics", + "file_type": 21, + "size": 5029, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "ff35af28-dbe9-47e6-b55b-2d7d01c4cc63", + "fields": { + "created_date": "2019-12-14T12:08:14.168Z", + "modified_date": "2019-12-14T12:08:14.168Z", + "file_name": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "file_type": 21, + "size": 13994, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "8954096e-64c4-4393-9721-95c5b880b18b", + "fields": { + "created_date": "2019-12-14T12:08:14.183Z", + "modified_date": "2019-12-14T12:08:14.183Z", + "file_name": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "file_type": 21, + "size": 12712, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "bdc504e0-bf83-4093-b14f-a6ce0ef94acc", + "fields": { + "created_date": "2019-12-14T12:08:14.203Z", + "modified_date": "2019-12-14T12:08:14.203Z", + "file_name": "s_C_K2902H_P001_d.rg.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md_metrics", + "file_type": 21, + "size": 2900, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "11a1da3d-5dad-493f-83a5-c5d5fe14d39e", + "fields": { + "created_date": "2019-12-14T12:08:14.219Z", + "modified_date": "2019-12-14T12:08:14.219Z", + "file_name": "s_C_K2902H_N001_d.rg.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md_metrics", + "file_type": 21, + "size": 2866, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dd8d50f9-389f-49e4-ae3a-17510322684c", + "fields": { + "created_date": "2019-12-14T12:08:14.242Z", + "modified_date": "2019-12-14T12:08:14.242Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "file_type": 11, + "size": 24213327, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "5d58f2d4-46dc-49f3-8e39-5c1e43a3d55b", + "fields": { + "created_date": "2019-12-14T12:08:14.263Z", + "modified_date": "2019-12-14T12:08:14.263Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "file_type": 21, + "size": 13440159, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d72930a5-6916-4d32-b9de-55c9e27a92df", + "fields": { + "created_date": "2019-12-14T12:08:14.302Z", + "modified_date": "2019-12-14T12:08:14.302Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "file_type": 11, + "size": 19739, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2e0d7c0a-be9c-4969-a65e-0139e95ebdc1", + "fields": { + "created_date": "2019-12-14T12:08:14.324Z", + "modified_date": "2019-12-14T12:08:14.324Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "file_type": 10, + "size": 5795, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2167517e-4230-4660-a3e2-f1f53d492e60", + "fields": { + "created_date": "2019-12-14T12:08:14.346Z", + "modified_date": "2019-12-14T12:08:14.346Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "file_type": 11, + "size": 403491742, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "587840dc-bcb6-48e6-9000-ae912c415d7c", + "fields": { + "created_date": "2019-12-14T12:08:14.390Z", + "modified_date": "2019-12-14T12:08:14.390Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "file_type": 21, + "size": 8622126, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "c1b4ba39-e14b-4535-88f1-53de2f5809c9", + "fields": { + "created_date": "2019-12-14T12:08:14.406Z", + "modified_date": "2019-12-14T12:08:14.406Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "file_type": 21, + "size": 8618530, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "df4b1eb1-640f-486c-846f-6df01c5896ac", + "fields": { + "created_date": "2019-12-14T12:08:14.428Z", + "modified_date": "2019-12-14T12:08:14.428Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "file_type": 21, + "size": 5494, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "5ed9c450-1af5-422c-8c74-f60219ad3d26", + "fields": { + "created_date": "2019-12-14T12:08:14.445Z", + "modified_date": "2019-12-14T12:08:14.445Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "file_type": 21, + "size": 5508, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "262c3d19-2d59-403d-bd2b-66e0fe404413", + "fields": { + "created_date": "2019-12-14T12:08:14.466Z", + "modified_date": "2019-12-14T12:08:14.466Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "file_type": 21, + "size": 32693698, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dfc3e0f6-be3c-4a1c-a2b7-fc8fb8791b1d", + "fields": { + "created_date": "2019-12-14T12:08:14.488Z", + "modified_date": "2019-12-14T12:08:14.488Z", + "file_name": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "file_type": 10, + "size": 13779990, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "4c1e5a08-70c1-4dcf-9d4b-b4d0d67ba3a7", + "fields": { + "created_date": "2019-12-14T12:08:14.504Z", + "modified_date": "2019-12-14T12:08:14.504Z", + "file_name": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "file_type": 10, + "size": 13586169, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "23fdfe62-3e90-4db4-b533-acadf2f4e1b2", + "fields": { + "created_date": "2019-12-14T12:08:14.527Z", + "modified_date": "2019-12-14T12:08:14.527Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "file_type": 21, + "size": 6648, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b950c7ff-84c1-4476-99e1-6f0b16626f76", + "fields": { + "created_date": "2019-12-14T12:08:14.544Z", + "modified_date": "2019-12-14T12:08:14.544Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "file_type": 21, + "size": 6632, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3cab6e36-70f5-46df-aa00-a4473cb8ed50", + "fields": { + "created_date": "2019-12-14T12:08:14.574Z", + "modified_date": "2019-12-14T12:08:14.575Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.gcbias.summary", + "file_type": 21, + "size": 1201, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "44f519d5-a59c-4baa-bf08-2792460c78bc", + "fields": { + "created_date": "2019-12-14T12:08:14.593Z", + "modified_date": "2019-12-14T12:08:14.593Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.gcbias.summary", + "file_type": 21, + "size": 1199, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "c211d274-6cf8-4f37-a201-1441b3f3c716", + "fields": { + "created_date": "2019-12-14T12:08:14.616Z", + "modified_date": "2019-12-14T12:08:14.616Z", + "file_name": "s_C_K2902H_P001_d.rg.md.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.ismetrics", + "file_type": 21, + "size": 7754, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "8265b3ed-0c3c-496c-ab97-ea312cf878db", + "fields": { + "created_date": "2019-12-14T12:08:14.635Z", + "modified_date": "2019-12-14T12:08:14.635Z", + "file_name": "s_C_K2902H_N001_d.rg.md.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.ismetrics", + "file_type": 21, + "size": 7041, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "8b2f58fc-ff9a-4d00-a3e2-c62228b99993", + "fields": { + "created_date": "2019-12-14T12:08:14.658Z", + "modified_date": "2019-12-14T12:08:14.658Z", + "file_name": "s_C_K2902H_P001_d.rg.md.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.pileup", + "file_type": 21, + "size": 55203868, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "995ae979-5156-4107-a9e6-20ce77f59ecb", + "fields": { + "created_date": "2019-12-14T12:08:14.675Z", + "modified_date": "2019-12-14T12:08:14.675Z", + "file_name": "s_C_K2902H_N001_d.rg.md.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.pileup", + "file_type": 21, + "size": 33915095, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "7ba48896-0c1a-443e-8258-0a35914dfd3e", + "fields": { + "created_date": "2019-12-14T12:08:14.697Z", + "modified_date": "2019-12-14T12:08:14.697Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "file_type": 21, + "size": 129554, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "86a62cf2-398d-4876-b195-e2780ba594bd", + "fields": { + "created_date": "2019-12-14T12:08:14.738Z", + "modified_date": "2019-12-14T12:08:14.738Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "file_type": 10, + "size": 172715192, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "92c9dd48-f4de-4788-b7a3-fe9ff7d17d7b", + "fields": { + "created_date": "2019-12-14T12:08:14.762Z", + "modified_date": "2019-12-14T12:08:14.762Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "file_type": 21, + "size": 13247144, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b16cea6f-7590-4a4f-9be2-38e045bf60cf", + "fields": { + "created_date": "2019-12-14T12:08:14.800Z", + "modified_date": "2019-12-14T12:08:14.800Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "file_type": 10, + "size": 11388, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3a95e8f1-aa34-4f81-b77a-ab59307c1d5f", + "fields": { + "created_date": "2019-12-14T12:08:14.822Z", + "modified_date": "2019-12-14T12:08:14.822Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "file_type": 10, + "size": 7525, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3f92509f-90a9-4de8-ad81-1d021607918b", + "fields": { + "created_date": "2019-12-14T12:08:14.844Z", + "modified_date": "2019-12-14T12:08:14.844Z", + "file_name": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.rg.md.hstmetrics", + "file_type": 21, + "size": 19302184, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "afe65a89-6272-4276-bb34-d401f41a480a", + "fields": { + "created_date": "2019-12-14T12:08:14.860Z", + "modified_date": "2019-12-14T12:08:14.860Z", + "file_name": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_N001_d.rg.md.hstmetrics", + "file_type": 21, + "size": 19114455, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daef2d43-6a6f-4c3c-9e80-076e3e8288cb", + "fields": { + "created_date": "2019-12-14T12:08:14.883Z", + "modified_date": "2019-12-14T12:08:14.883Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/ca18b090-03ad-4bef-acd3-52600f8e62eb/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "file_type": 11, + "size": 2741838, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.filemetadata", + "pk": "72a12af0-87e5-4499-b637-354ecfffd143", + "fields": { + "created_date": "2019-12-14T12:08:14.373Z", + "modified_date": "2019-12-14T12:08:14.373Z", + "file": "b835c33c-d241-42fc-beb2-e1ce1c41a77d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "84581b79-b529-48d8-859d-cdb1c6fa0d64", + "fields": { + "created_date": "2019-12-14T12:08:13.552Z", + "modified_date": "2019-12-14T12:08:13.552Z", + "file": "f9f55509-fcae-45f7-bdd2-72aebb59178e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "704672d7-5287-41c3-ac85-5216531cbcf7", + "fields": { + "created_date": "2019-12-14T12:08:13.580Z", + "modified_date": "2019-12-14T12:08:13.580Z", + "file": "e528ce76-0c6f-4088-8e22-38ece693bcdd", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ead69a0e-81b5-4284-bf78-35d08d99ea2e", + "fields": { + "created_date": "2019-12-14T12:08:13.619Z", + "modified_date": "2019-12-14T12:08:13.619Z", + "file": "f6d0fd8d-cae6-469d-ab57-f22ab55178c9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "01ea8211-218f-4625-a438-faa044bd1a6e", + "fields": { + "created_date": "2019-12-14T12:08:13.663Z", + "modified_date": "2019-12-14T12:08:13.663Z", + "file": "0f1e06cb-c77b-4988-994f-797eab18cbea", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "65c49729-041b-4f19-9131-82898ed0b61a", + "fields": { + "created_date": "2019-12-14T12:08:13.681Z", + "modified_date": "2019-12-14T12:08:13.681Z", + "file": "48dd6384-7034-4cc7-9027-7df71496eb27", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0850f29d-b7bb-4b24-b7bd-a375bdc765b6", + "fields": { + "created_date": "2019-12-14T12:08:13.700Z", + "modified_date": "2019-12-14T12:08:13.700Z", + "file": "2c2b195f-514c-4107-af3a-8488cf6547ea", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2b6174b0-2318-4de2-b485-59ff36594027", + "fields": { + "created_date": "2019-12-14T12:08:13.718Z", + "modified_date": "2019-12-14T12:08:13.718Z", + "file": "2af79d18-4ba7-4aef-8505-bd775d47b00d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2421fc51-3aeb-4cee-9eb0-67c7807eee41", + "fields": { + "created_date": "2019-12-14T12:08:13.736Z", + "modified_date": "2019-12-14T12:08:13.736Z", + "file": "2a1736ce-50fd-4721-92da-474f67318c8d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6d47e4f7-5bfe-4678-806c-4562a1389897", + "fields": { + "created_date": "2019-12-14T12:08:13.759Z", + "modified_date": "2019-12-14T12:08:13.759Z", + "file": "e6d2247d-c056-467b-8ddb-6cf6e0387f26", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "71931b44-b644-4402-b3f2-526b25474a4a", + "fields": { + "created_date": "2019-12-14T12:08:13.785Z", + "modified_date": "2019-12-14T12:08:13.785Z", + "file": "aecc788a-ebd8-4e3d-bb25-6bc6a373f5fa", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "86a688e6-2db8-4647-be8d-e529f5038ca8", + "fields": { + "created_date": "2019-12-14T12:08:13.807Z", + "modified_date": "2019-12-14T12:08:13.807Z", + "file": "e0ad9888-930b-4c87-9797-a5a88894cb2a", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4d2b5fa3-1bee-4650-89f9-40e9a28ac957", + "fields": { + "created_date": "2019-12-14T12:08:13.824Z", + "modified_date": "2019-12-14T12:08:13.824Z", + "file": "75f8f49a-ffe7-4cf4-8956-0adacfe9f6f6", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "31bb5596-e277-4821-abc8-2f7495fa6dc0", + "fields": { + "created_date": "2019-12-14T12:08:13.841Z", + "modified_date": "2019-12-14T12:08:13.841Z", + "file": "2a41fde8-172a-439c-8a9e-9681069c87fa", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5628c6c1-c5db-418d-9401-4a126e9447cb", + "fields": { + "created_date": "2019-12-14T12:08:13.863Z", + "modified_date": "2019-12-14T12:08:13.863Z", + "file": "463c0311-e32f-40ae-a1a2-d831431997b7", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3d21ff17-1aa1-44de-a0c4-867499102c9d", + "fields": { + "created_date": "2019-12-14T12:08:13.884Z", + "modified_date": "2019-12-14T12:08:13.884Z", + "file": "0fdc6110-b18f-4ef0-9c50-9905bf4a22a9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fb4fed4a-1c35-483d-8d6b-7c22ceb74b5b", + "fields": { + "created_date": "2019-12-14T12:08:13.900Z", + "modified_date": "2019-12-14T12:08:13.900Z", + "file": "9290ce2b-2dbd-4253-a4dd-9edf7fe79114", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f36e741f-128e-4aa6-8bcc-c784e9f15dc1", + "fields": { + "created_date": "2019-12-14T12:08:13.935Z", + "modified_date": "2019-12-14T12:08:13.935Z", + "file": "b9cd207a-f8d5-4c41-8506-f8bb6b0f61af", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "722de789-595e-4a9b-b810-62c64696fac7", + "fields": { + "created_date": "2019-12-14T12:08:13.952Z", + "modified_date": "2019-12-14T12:08:13.952Z", + "file": "22a814db-f3ad-4fb2-ae81-c56b41f01f13", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0dfbeac9-adab-4202-bc5e-a1bd8985b0cb", + "fields": { + "created_date": "2019-12-14T12:08:13.973Z", + "modified_date": "2019-12-14T12:08:13.973Z", + "file": "48a16d33-0fd4-41df-9bca-fe87c15c119e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "66929d7f-0abc-435c-8c92-a84b35328067", + "fields": { + "created_date": "2019-12-14T12:08:13.991Z", + "modified_date": "2019-12-14T12:08:13.991Z", + "file": "734731f7-a505-4aaa-957e-ce706342f555", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e151c4e1-c9c7-4e8b-83d9-b172e5688fe2", + "fields": { + "created_date": "2019-12-14T12:08:14.014Z", + "modified_date": "2019-12-14T12:08:14.014Z", + "file": "a813b899-7525-480b-9a8d-fe844abf06cf", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ba1bc7c9-be10-4035-8e50-db39c390859d", + "fields": { + "created_date": "2019-12-14T12:08:14.031Z", + "modified_date": "2019-12-14T12:08:14.032Z", + "file": "9cbfedb0-dac4-4151-ac25-2553fc46fad6", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9b8ac7d6-8edb-4a4c-8c13-6f906b355fbb", + "fields": { + "created_date": "2019-12-14T12:08:14.055Z", + "modified_date": "2019-12-14T12:08:14.055Z", + "file": "1e25988d-2f5d-45bf-ab60-a3e8bf3b0811", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d19c12b4-2fa8-4a51-9769-8d07b266c073", + "fields": { + "created_date": "2019-12-14T12:08:14.074Z", + "modified_date": "2019-12-14T12:08:14.074Z", + "file": "97923d95-86f5-4f95-ab20-3cb7882b79cc", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2413c312-0d3c-4736-9dab-54d7a1f8944b", + "fields": { + "created_date": "2019-12-14T12:08:14.097Z", + "modified_date": "2019-12-14T12:08:14.097Z", + "file": "ad08e7ac-2877-41da-a16a-f468f3130158", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0b44502d-24ae-4c76-b2df-d1c82dc7204e", + "fields": { + "created_date": "2019-12-14T12:08:14.113Z", + "modified_date": "2019-12-14T12:08:14.113Z", + "file": "7694cc12-25c1-4585-93ce-fa5c540b5f17", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9626b151-e5ce-4a8d-9a2d-5525ffefffea", + "fields": { + "created_date": "2019-12-14T12:08:14.135Z", + "modified_date": "2019-12-14T12:08:14.135Z", + "file": "4d8d1cf0-fc62-4ed6-a0bd-0dfbef86b277", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "73b90583-7ba5-479a-bf60-ae38fcb5101c", + "fields": { + "created_date": "2019-12-14T12:08:14.152Z", + "modified_date": "2019-12-14T12:08:14.152Z", + "file": "e4475a18-ce54-40c1-82cf-dd9323157658", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "022eb502-f9e7-470f-ba57-5a1fd64b4da6", + "fields": { + "created_date": "2019-12-14T12:08:14.172Z", + "modified_date": "2019-12-14T12:08:14.172Z", + "file": "ff35af28-dbe9-47e6-b55b-2d7d01c4cc63", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "960aa982-1fb2-4631-b6b9-9a785a038307", + "fields": { + "created_date": "2019-12-14T12:08:14.187Z", + "modified_date": "2019-12-14T12:08:14.187Z", + "file": "8954096e-64c4-4393-9721-95c5b880b18b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3e5cedc4-25ab-48f0-b00a-b1c11145a962", + "fields": { + "created_date": "2019-12-14T12:08:14.208Z", + "modified_date": "2019-12-14T12:08:14.208Z", + "file": "bdc504e0-bf83-4093-b14f-a6ce0ef94acc", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "af754099-8e4e-4b38-950e-b77c6d81e105", + "fields": { + "created_date": "2019-12-14T12:08:14.223Z", + "modified_date": "2019-12-14T12:08:14.223Z", + "file": "11a1da3d-5dad-493f-83a5-c5d5fe14d39e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6234948a-050c-4a5f-bb84-089ffa56e2ea", + "fields": { + "created_date": "2019-12-14T12:08:14.246Z", + "modified_date": "2019-12-14T12:08:14.246Z", + "file": "dd8d50f9-389f-49e4-ae3a-17510322684c", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "acfe275c-f258-4a51-afd2-85c71d54eefd", + "fields": { + "created_date": "2019-12-14T12:08:14.268Z", + "modified_date": "2019-12-14T12:08:14.268Z", + "file": "5d58f2d4-46dc-49f3-8e39-5c1e43a3d55b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f2821b20-55b8-4874-aa4e-4e7138a8b63b", + "fields": { + "created_date": "2019-12-14T12:08:14.307Z", + "modified_date": "2019-12-14T12:08:14.307Z", + "file": "d72930a5-6916-4d32-b9de-55c9e27a92df", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "7493cb24-e54e-48ce-89a2-f3a9beab499d", + "fields": { + "created_date": "2019-12-14T12:08:14.329Z", + "modified_date": "2019-12-14T12:08:14.329Z", + "file": "2e0d7c0a-be9c-4969-a65e-0139e95ebdc1", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "00abf8aa-8c97-41e0-b294-8299d1315763", + "fields": { + "created_date": "2019-12-14T12:08:14.351Z", + "modified_date": "2019-12-14T12:08:14.351Z", + "file": "2167517e-4230-4660-a3e2-f1f53d492e60", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5c6a0c54-ae10-41ad-8d48-2191f23f6ee9", + "fields": { + "created_date": "2019-12-14T12:08:14.394Z", + "modified_date": "2019-12-14T12:08:14.394Z", + "file": "587840dc-bcb6-48e6-9000-ae912c415d7c", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "75c071df-9735-4f5e-9d11-338364c3f3f5", + "fields": { + "created_date": "2019-12-14T12:08:14.411Z", + "modified_date": "2019-12-14T12:08:14.411Z", + "file": "c1b4ba39-e14b-4535-88f1-53de2f5809c9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ff6f734-4ac5-4c0b-ae9c-1c66915a4de6", + "fields": { + "created_date": "2019-12-14T12:08:14.432Z", + "modified_date": "2019-12-14T12:08:14.432Z", + "file": "df4b1eb1-640f-486c-846f-6df01c5896ac", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9c20e7a4-03be-4764-89bc-e6365f4a2f9a", + "fields": { + "created_date": "2019-12-14T12:08:14.449Z", + "modified_date": "2019-12-14T12:08:14.449Z", + "file": "5ed9c450-1af5-422c-8c74-f60219ad3d26", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8c5372f6-7d52-4d58-8ed0-1b3ef7e72a01", + "fields": { + "created_date": "2019-12-14T12:08:14.470Z", + "modified_date": "2019-12-14T12:08:14.470Z", + "file": "262c3d19-2d59-403d-bd2b-66e0fe404413", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8a4038d5-9ecb-40ed-a964-1163f83abb17", + "fields": { + "created_date": "2019-12-14T12:08:14.492Z", + "modified_date": "2019-12-14T12:08:14.492Z", + "file": "dfc3e0f6-be3c-4a1c-a2b7-fc8fb8791b1d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c1314a25-14fe-4420-b272-af86064e0d17", + "fields": { + "created_date": "2019-12-14T12:08:14.509Z", + "modified_date": "2019-12-14T12:08:14.509Z", + "file": "4c1e5a08-70c1-4dcf-9d4b-b4d0d67ba3a7", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9ba79561-0602-408b-b963-cb46c53658ea", + "fields": { + "created_date": "2019-12-14T12:08:14.532Z", + "modified_date": "2019-12-14T12:08:14.532Z", + "file": "23fdfe62-3e90-4db4-b533-acadf2f4e1b2", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "cb3bf695-96b9-4fce-a562-48fdad6939f6", + "fields": { + "created_date": "2019-12-14T12:08:14.548Z", + "modified_date": "2019-12-14T12:08:14.548Z", + "file": "b950c7ff-84c1-4476-99e1-6f0b16626f76", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "95bbe477-eac9-4f0c-8207-d2dc6bfe536f", + "fields": { + "created_date": "2019-12-14T12:08:14.580Z", + "modified_date": "2019-12-14T12:08:14.580Z", + "file": "3cab6e36-70f5-46df-aa00-a4473cb8ed50", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "41764b23-c374-4d24-884f-5341047ba4e3", + "fields": { + "created_date": "2019-12-14T12:08:14.598Z", + "modified_date": "2019-12-14T12:08:14.598Z", + "file": "44f519d5-a59c-4baa-bf08-2792460c78bc", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fb5431c0-e7ae-4ef0-b71c-fa81838977c4", + "fields": { + "created_date": "2019-12-14T12:08:14.621Z", + "modified_date": "2019-12-14T12:08:14.621Z", + "file": "c211d274-6cf8-4f37-a201-1441b3f3c716", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "13deb153-5dad-4e83-9e61-91262e14e416", + "fields": { + "created_date": "2019-12-14T12:08:14.640Z", + "modified_date": "2019-12-14T12:08:14.640Z", + "file": "8265b3ed-0c3c-496c-ab97-ea312cf878db", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e93ee833-0002-4e3e-8cf1-69e81a18c65b", + "fields": { + "created_date": "2019-12-14T12:08:14.663Z", + "modified_date": "2019-12-14T12:08:14.663Z", + "file": "8b2f58fc-ff9a-4d00-a3e2-c62228b99993", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a2950c05-2e28-42b2-9594-bf05be09dd09", + "fields": { + "created_date": "2019-12-14T12:08:14.679Z", + "modified_date": "2019-12-14T12:08:14.679Z", + "file": "995ae979-5156-4107-a9e6-20ce77f59ecb", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "732c5c6a-0e3e-42bf-9ae0-dd014c03ff60", + "fields": { + "created_date": "2019-12-14T12:08:14.702Z", + "modified_date": "2019-12-14T12:08:14.702Z", + "file": "7ba48896-0c1a-443e-8258-0a35914dfd3e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b3af6100-e256-49e3-9e0b-76e4db510f10", + "fields": { + "created_date": "2019-12-14T12:08:14.743Z", + "modified_date": "2019-12-14T12:08:14.743Z", + "file": "86a62cf2-398d-4876-b195-e2780ba594bd", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "7d8dd044-53eb-4735-982d-d07804986d46", + "fields": { + "created_date": "2019-12-14T12:08:14.766Z", + "modified_date": "2019-12-14T12:08:14.766Z", + "file": "92c9dd48-f4de-4788-b7a3-fe9ff7d17d7b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9957d731-e1ad-431e-a1a9-1fd825dca32a", + "fields": { + "created_date": "2019-12-14T12:08:14.805Z", + "modified_date": "2019-12-14T12:08:14.805Z", + "file": "b16cea6f-7590-4a4f-9be2-38e045bf60cf", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5e3401fc-64b8-4047-838d-19cb6589cd63", + "fields": { + "created_date": "2019-12-14T12:08:14.827Z", + "modified_date": "2019-12-14T12:08:14.827Z", + "file": "3a95e8f1-aa34-4f81-b77a-ab59307c1d5f", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "70889fa4-5c6a-4ee4-9dd4-b7b9a16f6d68", + "fields": { + "created_date": "2019-12-14T12:08:14.848Z", + "modified_date": "2019-12-14T12:08:14.848Z", + "file": "3f92509f-90a9-4de8-ad81-1d021607918b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d81be683-8fb2-42c1-94a7-e4e777bce313", + "fields": { + "created_date": "2019-12-14T12:08:14.865Z", + "modified_date": "2019-12-14T12:08:14.865Z", + "file": "afe65a89-6272-4276-bb34-d401f41a480a", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f63728b5-80b8-4783-80a1-2b5c60d51955", + "fields": { + "created_date": "2019-12-14T12:08:14.887Z", + "modified_date": "2019-12-14T12:08:14.887Z", + "file": "daef2d43-6a6f-4c3c-9e80-076e3e8288cb", + "version": 0, + "metadata": {}, + "user": null + } + } +] diff --git a/runner/operator/roslin_qc_operator/bin/__init__.py b/runner/operator/roslin_qc_operator/bin/__init__.py new file mode 100644 index 000000000..e69de29bb diff --git a/runner/operator/roslin_qc_operator/bin/input.py b/runner/operator/roslin_qc_operator/bin/input.py new file mode 100644 index 000000000..06f61d10c --- /dev/null +++ b/runner/operator/roslin_qc_operator/bin/input.py @@ -0,0 +1,282 @@ +""" +Module for generating input dataset for use with Roslin QC operator + +Example input datastructure format: + +db_files: + fp_genotypes: db_files['value']['fp_genotypes'] + hotspot_list_maf: db_files['value']['hotspot_list_maf'] + conpair_markers: db_files['value']['conpair_markers'] +runparams: + project_prefix: runparams['value']['project_prefix'] + genome: runparams['value']['genome'] + scripts_bin: runparams['value']['scripts_bin'] + assay: ---MISSING--- + pi: ---MISSING--- + pi-email: ---MISSING--- +ref_fasta: ref_fasta +clstats1: [clstats1] +clstats2: [clstats2] +md_metrics: [md_metrics] +hs_metrics: [hs_metrics] +insert_metrics: [insert_metrics] +per_target_coverage: [per_target_coverage] +qual_metrics: [qual_metrics] +doc_basecounts: [doc_basecounts] +conpair_pileups: [conpair_pileups] +pairs: [pair] +""" +import json +import urllib +from file_system.models import FileMetadata +from runner.models import Port +from pprint import pprint + +def build_sample(filemetadata_instance, company_name = "MSKCC", platform = "Illumina"): + """ + Create base Roslin CWL sample datastructure from the FileMetadata + """ + sample = {} + sample['CN'] = company_name + sample['PL'] = platform + sample['PU'] = filemetadata_instance.metadata['flowCellId'] + sample['LB'] = filemetadata_instance.metadata['libraryId'] + sample['tumor_type'] = filemetadata_instance.metadata['tumorOrNormal'] + sample['ID'] = '_'.join([filemetadata_instance.metadata['sampleName'], filemetadata_instance.metadata['flowCellId']]) + sample['SM'] = filemetadata_instance.metadata['sampleName'] + sample['species'] = filemetadata_instance.metadata['species'] + sample['patient_id'] = filemetadata_instance.metadata['patientId'] + sample['bait_set'] = filemetadata_instance.metadata['baitSet'] + sample['igo_id'] = filemetadata_instance.metadata['sampleId'] + sample['run_date'] = filemetadata_instance.metadata['runDate'] + sample['specimen_type'] = filemetadata_instance.metadata['specimenType'] + sample['request_id'] = filemetadata_instance.metadata['requestId'] + return(sample) + +def file_to_cwl(file_instance): + """ + Convert a Beagle File instance into a dict in CWL File format dict + + example: + {'class': 'File', 'path': '/path/to/foo.txt'} + """ + d = { + 'class': 'File', + 'path': file_instance.path + } + return(d) + +def path_to_cwl(filepath): + """ + Convert a filepath string into a CWL File format dict + """ + d = { + 'class': 'File', + 'path': filepath + } + return(d) + +def get_assay_from_run(run_instance): + """ + Return the assay from a Run instance + This is a hold-over method until Run instance db model gets updated; update this later + """ + return(run_instance.output_metadata['assay']) + +def create_files_data_from_ports_with_names(ports): + """ + Retrieve the File entries for each Port entry, while keeping the associated Port.name attribute + """ + # list of dicts for File and 'name' + # TODO: use a Django query instead of iteration + files = [] + for port in ports: + for file in port.files.all(): + file_cwl = file_to_cwl(file) + d = { 'name': port.name, 'file': file_cwl } + files.append(d) + return(files) + +def parse_pairs_from_ports(ports_queryset): + """ + Search the set of Ports for "pair" entries and format them into a list of tumor normal pair entries + """ + pair_ports = ports_queryset.filter(name = "pair") + pairs = [] + + # get the tumor and normal R1 and R2 items from FileMetadata assocaited with File's associated with each Port + all_pair_items = [] + for port in pair_ports: + pair_items = [] + # all the Files assocaited with a Port + files = port.files.all() + for file in files: + # get the highest 'version' number FileMetadata instance for the File + filemetata_instance = FileMetadata.objects.filter(file = file).order_by('-version').first() + R1_or_R2 = filemetata_instance.metadata['R'] + tumor_or_normal = filemetata_instance.metadata['tumorOrNormal'] + pair_items.append( {'filemetadata': filemetata_instance, 'R1_or_R2': R1_or_R2, 'tumor_or_normal': tumor_or_normal } ) + all_pair_items.append(pair_items) + + # parse the entries into a sensible mapping of tumor and normal R1 and R2 + for pair_items in all_pair_items: + pair_set = {} + pair_set['tumor'] = {} + pair_set['normal'] = {} + # TODO: how to handle case where wrong number of items are associated? Should be 1 of each tumor/normal + R1/R2 + for item in pair_items: + if item['tumor_or_normal'] == 'Tumor' and item['R1_or_R2'] == 'R1': + pair_set['tumor']['R1'] = item['filemetadata'] + elif item['tumor_or_normal'] == 'Tumor' and item['R1_or_R2'] == 'R2': + pair_set['tumor']['R2'] = item['filemetadata'] + elif item['tumor_or_normal'] == 'Normal' and item['R1_or_R2'] == 'R1': + pair_set['normal']['R1'] = item['filemetadata'] + elif item['tumor_or_normal'] == 'Normal' and item['R1_or_R2'] == 'R2': + pair_set['normal']['R2'] = item['filemetadata'] + pairs.append(pair_set) + return(pairs) + +def pair_to_cwl(pair): + """ + Convert a single tumor normal pair dict to CWL format datastructure + + pair = { + 'normal': { + 'R1': FileMetadata, + 'R2': FileMetadata + }, + 'tumor': { + 'R1': FileMetadata, + 'R2': FileMetadata + } + """ + # get the base datastructure dict for each R1 and R2 + normal_r1 = build_sample(pair['normal']['R1']) + normal_r2 = build_sample(pair['normal']['R2']) + tumor_r1 = build_sample(pair['tumor']['R1']) + tumor_r2 = build_sample(pair['tumor']['R2']) + + # merge the dict's; the second dict will overwrite args from the first + normal = {**normal_r1, **normal_r2} + normal['R1'] = file_to_cwl(pair['normal']['R1'].file) + normal['R2'] = file_to_cwl(pair['normal']['R2'].file) + + tumor = {**tumor_r1, **tumor_r2} + tumor['R1'] = file_to_cwl(pair['tumor']['R1'].file) + tumor['R2'] = file_to_cwl(pair['tumor']['R2'].file) + + output = (tumor, normal) + return(output) + +def parse_runparams_from_ports(ports_queryset): + """ + Get the runparams from a Port queryset + """ + # TODO: how to ensure the correct number of Port items? Should be 1 + param_port = ports_queryset.filter(name = "runparams").first() + runparams = {} + runparams['project_prefix'] = param_port.value['project_prefix'] + runparams['genome'] = param_port.value['genome'] + runparams['scripts_bin'] = param_port.value['scripts_bin'] + + # TODO: find a way to handle + runparams['pi'] = "NA" + runparams['pi-email'] = "NA" + return(runparams) + +def get_db_files(assay, references_json = "runner/operator/roslin_operator/reference_jsons/roslin_resources.json"): + """ + Return a dict with the required reference file paths + """ + references = json.load(open(references_json)) + db_files = {} + db_files['fp_genotypes'] = references["targets"][assay]['FP_genotypes'] + db_files['hotspot_list_maf'] = references["request_files"]['hotspot_list_maf'] + db_files['conpair_markers'] = references["request_files"]['conpair_markers'] + db_files['ref_fasta'] = references["request_files"]['ref_fasta'] + + # check for URI ref_fasta; 'juno:///juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta' + for key, value in db_files.items(): + if value.startswith('juno:///'): + parts = urllib.parse.urlsplit(value) + db_files[key] = path_to_cwl(parts.path) + elif value.startswith('/'): + db_files[key] = path_to_cwl(value) + # TODO: what to do if its not either of these cases? + + return(db_files) + +def parse_outputs_files_data(files_data): + """ + Generate an input dataset from a list of dicts of File objects and their associated Port.name value + Uses items that came from a pipeline output + + files_data = [{ 'name': Port.name, 'file': {'class': 'File', 'path': '/path/to/foo.txt'} }, ... ] + """ + # initialize the output data to use for starting QC pipeline + qc_input = {} + qc_input['clstats1'] = [] + qc_input['clstats2'] = [] + qc_input['md_metrics'] = [] + qc_input['hs_metrics'] = [] + qc_input['insert_metrics'] = [] + qc_input['per_target_coverage'] = [] + qc_input['qual_metrics'] = [] + qc_input['doc_basecounts'] = [] + qc_input['conpair_pileups'] = [] + + for item in files_data: + item_type = item['name'] + file_cwl = item['file'] + + # append values for known keys + # TODO: do we need to enforce unique-ness here? Do we need to enfore unique on file basename as well? + if item_type in qc_input: + if file_cwl not in qc_input[item_type]: + qc_input[item_type].append(file_cwl) + return(qc_input) + +def build_inputs_from_runs(run_queryset, _assay = None): + """ + Build the Roslin QC pipeline inputs data structure from a set of Roslin Voyager pipeline Run instances + """ + # get the input and output Ports of the run + ports = Port.objects.filter(run__in = run_queryset) + + # get the list of tumor normal pairs out of the Ports + pairs = parse_pairs_from_ports(ports) + + # convert the pairs to CWL format datastructure + pairs_cwl = [] + for pair_set in pairs: + pair_cwl = pair_to_cwl(pair_set) + pairs_cwl.append(pair_cwl) + + # get the File entries while keeping Port.name; needed for later parsing + files_data = create_files_data_from_ports_with_names(ports) + input_files = parse_outputs_files_data(files_data) + + # need to get the assay type so that we can get the correct reference files later + # TODO: how to handle multiple runs? just use the first one for now... + if _assay == None: + assay = get_assay_from_run(run_queryset.first()) + else: + assay = str(_assay) + + # find the Port with 'runparams' needed for QC input + runparams = parse_runparams_from_ports(ports) + runparams['assay'] = assay + + # get the correct reference files based on assay type + db_files = get_db_files(assay) + ref_fasta = db_files.pop('ref_fasta') + + # build the final data dict for QC input + qc_input = {} + qc_input['db_files'] = db_files + qc_input['runparams'] = runparams + qc_input['pairs'] = pairs_cwl + qc_input['ref_fasta'] = ref_fasta + qc_input = {**qc_input, **input_files} + + return(qc_input) diff --git a/runner/tests/operator/roslin_qc_operator/test_input.py b/runner/tests/operator/roslin_qc_operator/test_input.py new file mode 100644 index 000000000..03d6e9b08 --- /dev/null +++ b/runner/tests/operator/roslin_qc_operator/test_input.py @@ -0,0 +1,273 @@ +""" +Tests for Roslin QC input parsing methods +""" +import os +import json +from uuid import UUID +from django.test import TestCase +from django.conf import settings +from django.core.management import call_command +from file_system.models import File, FileMetadata, FileGroup +from runner.models import Run, Port, PortType +from runner.operator.roslin_qc_operator.bin.input import parse_outputs_files_data +from runner.operator.roslin_qc_operator.bin.input import parse_pairs_from_ports +from runner.operator.roslin_qc_operator.bin.input import parse_runparams_from_ports +from runner.operator.roslin_qc_operator.bin.input import get_db_files +from runner.operator.roslin_qc_operator.bin.input import get_assay_from_run +from runner.operator.roslin_qc_operator.bin.input import build_inputs_from_runs +from runner.operator.roslin_qc_operator.bin.input import file_to_cwl +from runner.operator.roslin_qc_operator.bin.input import path_to_cwl +from runner.operator.roslin_qc_operator.bin.input import build_sample +from runner.operator.roslin_qc_operator.bin.input import pair_to_cwl +from pprint import pprint + +class TestInput(TestCase): + fixtures = [ + "file_system.filegroup.json", + "file_system.filetype.json", + "file_system.storage.json", + "runner.pipeline.json" + ] + + def test_true(self): + self.assertTrue(True) + + def test_validate_fixtures1(self): + """ + Check the validity of the fixtures for use with testing for this module to make sure it matches expected criteria + Using saved Roslin pipeline output dataset + """ + # start with empty db + self.assertTrue(len(Run.objects.all()) == 0) + self.assertTrue(len(Port.objects.all()) == 0) + self.assertTrue(len(File.objects.all()) == 0) + self.assertTrue(len(FileMetadata.objects.all()) == 0) + + # load test pipeline Run output fixtures + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + + # make sure fixtures match expected criteria + self.assertTrue(len(Run.objects.all()) == 1) + self.assertTrue(len(Port.objects.all()) == 47) + self.assertTrue(len(File.objects.all()) == 121) + self.assertTrue(len(FileMetadata.objects.all()) == 121) + + # make sure expected number of inputs and outputs exist + run_instance = Run.objects.first() + self.assertEqual(len(run_instance.port_set.filter(port_type=PortType.INPUT)), 12) + self.assertEqual(len(run_instance.port_set.filter(port_type=PortType.OUTPUT)), 35) + + def test_file_to_cwl1(self): + """ + Test conversion of a File instance to an equivalent CWL entry + """ + file_instance = File.objects.create( + file_group = FileGroup.objects.first(), + path = "/path/to/foo.txt") + file_cwl = file_to_cwl(file_instance) + expected_file_cwl = {'class': 'File', 'path': '/path/to/foo.txt'} + self.assertEqual(file_cwl, expected_file_cwl) + + def test_path_to_cwl1(self): + """ + Test conversion of a string based file path into CWL File format dict + """ + file_cwl = path_to_cwl('/path/to/foo.txt') + expected_file_cwl = {'class': 'File', 'path': '/path/to/foo.txt'} + self.assertEqual(file_cwl, expected_file_cwl) + + def test_get_assay_from_run1(self): + """ + Test that correct assay is returned from fixture + This behavior is likely to change in the future + """ + # load test pipeline Run output fixtures + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + run_instance = Run.objects.first() + assay = get_assay_from_run(run_instance) + self.assertEqual(assay, 'IDT_Exome_v1_FP_b37') + + def test_build_sample1(self): + """ + Test building of the base dict datastructure to be used later in Roslin CWL output + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + file_instance = File.objects.get(file_name = 'P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz') + filemetadata_instance = FileMetadata.objects.filter(file = file_instance).order_by('-version').first() + sample = build_sample(filemetadata_instance = filemetadata_instance) + expected_sample = {'CN': 'MSKCC', + 'ID': 'C-K2902H-N001-d_H7FKJBBXY', + 'LB': '09670_D_46_1', + 'PL': 'Illumina', + 'PU': 'H7FKJBBXY', + 'SM': 'C-K2902H-N001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_46', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-19', + 'species': 'Human', + 'specimen_type': 'Blood', + 'tumor_type': 'Normal'} + self.assertEqual(sample, expected_sample) + + def test_parse_pairs_from_ports1(self): + """ + Test that pairs are properly constructed from Port objects + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + run_instance = Run.objects.first() + ports = run_instance.port_set.all() + pairs = parse_pairs_from_ports(ports) + + tumor_R2 = FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz")) + turmor_R1 = FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz")) + normal_R2 = FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz")) + normal_R1 = FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz")) + + expected_pairs = [{ + 'normal': { + 'R1': normal_R1, + 'R2': normal_R2 + }, + 'tumor': { + 'R1': turmor_R1, + 'R2': tumor_R2 + } + }] + self.assertEqual(pairs, expected_pairs) + + def test_pair_to_cwl1(self): + """ + Test conversion of single pair to base CWL datastructure format + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + pair = { + 'normal': { + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz")) + }, + 'tumor': { + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz")) + } + } + + pair_cwl = pair_to_cwl(pair) + + expected_pair_cwl = ({'CN': 'MSKCC', + 'ID': 'C-K2902H-P001-d_H7HCTBBXY', + 'LB': '09670_D_1_1_1_1_1', + 'PL': 'Illumina', + 'PU': 'H7HCTBBXY', + 'R1': {'class': 'File', + 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz'}, + 'R2': {'class': 'File', + 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz'}, + 'SM': 'C-K2902H-P001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_1', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-15', + 'species': 'Human', + 'specimen_type': 'Biopsy', + 'tumor_type': 'Tumor'}, + {'CN': 'MSKCC', + 'ID': 'C-K2902H-N001-d_H7FKJBBXY', + 'LB': '09670_D_46_1', + 'PL': 'Illumina', + 'PU': 'H7FKJBBXY', + 'R1': {'class': 'File', + 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz'}, + 'R2': {'class': 'File', + 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz'}, + 'SM': 'C-K2902H-N001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_46', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-19', + 'species': 'Human', + 'specimen_type': 'Blood', + 'tumor_type': 'Normal'}) + self.assertEqual(pair_cwl, expected_pair_cwl) + + def test_parse_runparams_from_ports1(self): + """ + Test that runparams are correctly parsed from Port queryset + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + run_instance = Run.objects.first() + ports = run_instance.port_set.all() + runparams = parse_runparams_from_ports(ports) + expected_runparams = {'genome': 'GRCh37', + 'pi': 'NA', + 'pi-email': 'NA', + 'project_prefix': ['09670_D'], + 'scripts_bin': '/usr/bin'} + self.assertEqual(runparams, expected_runparams) + + def test_get_db_files(self): + """ + Test that db_files are returned correctly + """ + assay = "IDT_Exome_v1_FP_b37" + db_files = get_db_files(assay) + expected_db_files = { + 'conpair_markers': {'class': 'File', 'path': '/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt'}, + 'fp_genotypes': {'class': 'File', 'path': '/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.txt'}, + 'hotspot_list_maf': {'class': 'File', 'path': '/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf'}, + 'ref_fasta': {'class': 'File', 'path': '/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta'} + } + self.assertEqual(db_files, expected_db_files) + + def test_parse_outputs_files_data1(self): + """ + Test that a series of files are correctly organized into dict for QC input + """ + files_data = [ + {'name': 'clstats1', 'file': {'class': 'File', 'path': '/path/to/clstats1.txt'} }, + {'name': 'clstats2', 'file': {'class': 'File', 'path': '/path/to/clstats2.txt'} }, + {'name': 'md_metrics', 'file': {'class': 'File', 'path': '/path/to/md_metrics.txt'} }, + {'name': 'hs_metrics', 'file': {'class': 'File', 'path': '/path/to/hs_metrics.txt'} }, + {'name': 'insert_metrics', 'file': {'class': 'File', 'path': '/path/to/insert_metrics.txt'} }, + {'name': 'per_target_coverage', 'file': {'class': 'File', 'path': '/path/to/per_target_coverage.txt'} }, + {'name': 'qual_metrics', 'file': {'class': 'File', 'path': '/path/to/qual_metrics.txt'} }, + {'name': 'doc_basecounts', 'file': {'class': 'File', 'path': '/path/to/doc_basecounts.txt'} }, + {'name': 'conpair_pileups', 'file': {'class': 'File', 'path': '/path/to/conpair_pileups.txt'} } + ] + qc_input = parse_outputs_files_data(files_data) + expected_qc_input = { + 'clstats1': [{'class': 'File', 'path': '/path/to/clstats1.txt'}], + 'clstats2': [{'class': 'File', 'path': '/path/to/clstats2.txt'}], + 'md_metrics': [{'class': 'File', 'path': '/path/to/md_metrics.txt'}], + 'hs_metrics': [{'class': 'File', 'path': '/path/to/hs_metrics.txt'}], + 'insert_metrics': [{'class': 'File', 'path': '/path/to/insert_metrics.txt'}], + 'per_target_coverage': [{'class': 'File', 'path': '/path/to/per_target_coverage.txt'}], + 'qual_metrics': [{'class': 'File', 'path': '/path/to/qual_metrics.txt'}], + 'doc_basecounts': [{'class': 'File', 'path': '/path/to/doc_basecounts.txt'}], + 'conpair_pileups': [{'class': 'File', 'path': '/path/to/conpair_pileups.txt'}], + } + self.assertEqual(qc_input, expected_qc_input) + + + def test_build_inputs_from_run_and_ports1(self): + """ + Test generation of Roslin QC input from Roslin pipeline output Run and Port instances + """ + # load test pipeline Run output fixtures + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + + run_queryset = Run.objects.all() + + qc_input = build_inputs_from_runs(run_queryset) + + # print(json.dumps(qc_input, indent = 4)) From 83bf428ffb89bd3beab389793cf5dab592c25a9f Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Tue, 11 Feb 2020 12:49:49 -0500 Subject: [PATCH 05/31] add tests for serializer using output_metadata field --- Makefile | 17 ++++-- runner/tests/serializers/__init__.py | 0 runner/tests/serializers/test_serializers.py | 63 ++++++++++++++++++++ 3 files changed, 76 insertions(+), 4 deletions(-) create mode 100644 runner/tests/serializers/__init__.py create mode 100644 runner/tests/serializers/test_serializers.py diff --git a/Makefile b/Makefile index 1df4ead96..d0acb3d9d 100644 --- a/Makefile +++ b/Makefile @@ -217,7 +217,7 @@ check-env: BEAGLE_AUTH_LDAP_SERVER_URI \ BEAGLE_LIMS_PASSWORD \ BEAGLE_LIMS_USERNAME; do \ - [ -z "$$(printenv BEAGLE_LIMS_USERNAME)" ] && echo ">>> env variable $$i is not set; some features may not work" || : ; done + [ -z "$$(printenv $$i)" ] && echo ">>> env variable $$i is not set; some features may not work" || : ; done # start the RabbitMQ server in the background rabbitmq-start: $(LOG_DIR_ABS) @@ -436,10 +436,11 @@ file-get: http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/fs/files/?filename=$(REQFILE) # start a Roslin run for a given request in the Beagle db -run-request: +run-request: $(AUTH_FILE) + @token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ curl -H "Content-Type: application/json" \ -X POST \ - -H "Authorization: Bearer $(TOKEN)" \ + -H "Authorization: Bearer $$token" \ --data '{"request_ids":["$(REQID)"], "pipeline_name": "roslin"}' \ http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/run/request/ @@ -467,12 +468,20 @@ $(DEMO_INPUT): $(INPUT_TEMPLATE) $(AUTH_FILE) .PHONY: $(DEMO_INPUT) # submit a demo Roslin run using the dev Roslin pipeline entry in the database -demo-run: register-dev-pipeline $(DEMO_INPUT) +# submit using the API endpoint; bypasses the Operator +demo-run-api: register-dev-pipeline $(DEMO_INPUT) @python manage.py loaddata fixtures/tests/juno_roslin_demo2.file.json @python manage.py loaddata fixtures/tests/juno_roslin_demo2.filemetadata.json @python manage.py loaddata fixtures/tests/roslin_reference_files.json @$(MAKE) run-request-api REQID=DemoRequest1 REQJSON=$(DEMO_INPUT) +# submit using standard request; uses the Operator +demo-run: register-dev-pipeline $(DEMO_INPUT) + @python manage.py loaddata fixtures/tests/juno_roslin_demo2.file.json + @python manage.py loaddata fixtures/tests/juno_roslin_demo2.filemetadata.json + @python manage.py loaddata fixtures/tests/roslin_reference_files.json + $(MAKE) run-request REQID=DemoRequest1 + # check if the ports needed for services and servers are already in use on this system ifeq ($(UNAME), Darwin) # On macOS High Sierra, use this command: lsof -nP -i4TCP:$PORT | grep LISTEN diff --git a/runner/tests/serializers/__init__.py b/runner/tests/serializers/__init__.py new file mode 100644 index 000000000..e69de29bb diff --git a/runner/tests/serializers/test_serializers.py b/runner/tests/serializers/test_serializers.py new file mode 100644 index 000000000..1ea9e5ff2 --- /dev/null +++ b/runner/tests/serializers/test_serializers.py @@ -0,0 +1,63 @@ +""" +Tests for serialzers +""" +from django.test import TestCase +from uuid import UUID +from runner.serializers import APIRunCreateSerializer +from runner.models import Run + +class TestSerializers(TestCase): + fixtures = [ + "file_system.filegroup.json", + "file_system.filetype.json", + "file_system.storage.json", + "runner.pipeline.json" + ] + + def test_create_run_serializer1(self): + """ + Test that the API Run Create Serializer works and creates a Run + """ + # start with 0 runs in the database + self.assertEqual(len(Run.objects.all()), 0) + + # data to pass to serializer + data = { + 'app': 'cb5d793b-e650-4b7d-bfcd-882858e29cc5', + 'inputs': [], + 'name': 'ROSLIN 10075_D, 1 of 1', + 'tags': {'requestId': '10075_D'} + } + + # run the serialzer + serializer = APIRunCreateSerializer(data = data) + serializer.is_valid() + run = serializer.save() + + # should be a Run in the database now + self.assertEqual(len(Run.objects.all()), 1) + + run_instance = Run.objects.all()[0] + self.assertEqual(run_instance.app_id, UUID('cb5d793b-e650-4b7d-bfcd-882858e29cc5')) + self.assertTrue(run_instance.name.startswith(data['name'])) + self.assertEqual(run_instance.tags, {'requestId': '10075_D'}) + self.assertEqual(run_instance.status, 0) + + def test_create_run_with_output_metadata1(self): + """ + Test that output_metadata propagates to the Run instance created + """ + data = { + 'app': 'cb5d793b-e650-4b7d-bfcd-882858e29cc5', + 'inputs': [], + 'name': 'foo Run', + 'output_metadata': {'assay':'IMPACT486'} + } + serializer = APIRunCreateSerializer(data = data) + serializer.is_valid() + run = serializer.save() + run_instance = Run.objects.all()[0] + self.assertEqual(run_instance.app_id, UUID('cb5d793b-e650-4b7d-bfcd-882858e29cc5')) + self.assertTrue(run_instance.name.startswith(data['name'])) + self.assertEqual(run_instance.status, 0) + self.assertEqual(run_instance.output_metadata, data['output_metadata']) From 9e3419b05607ef48132494f0d280c9c07bd893fe Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 12 Feb 2020 16:40:41 -0500 Subject: [PATCH 06/31] update demo run methods and input.json template --- Makefile | 21 ++++++++++++++++--- .../juno_roslin_demo2.pipeline_input.json | 20 ++++++++++++++---- 2 files changed, 34 insertions(+), 7 deletions(-) diff --git a/Makefile b/Makefile index 1df4ead96..6c0942b28 100644 --- a/Makefile +++ b/Makefile @@ -426,6 +426,7 @@ files-request: --data '{"request_ids":["$(REQID)"]}' \ http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/fs/files/ # python ./beagle_cli.py files list --metadata='requestId:$(REQID)' +# http://localhost:6991/v0/fs/files/?metadata=requestId:DemoRequest1 # get info on a single file REQFILE:=b37.fasta @@ -436,22 +437,27 @@ file-get: http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/fs/files/?filename=$(REQFILE) # start a Roslin run for a given request in the Beagle db -run-request: +run-request: $(AUTH_FILE) + token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ + echo ">>> token: $$token" && \ curl -H "Content-Type: application/json" \ -X POST \ - -H "Authorization: Bearer $(TOKEN)" \ + -H "Authorization: Bearer $$token" \ --data '{"request_ids":["$(REQID)"], "pipeline_name": "roslin"}' \ http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/run/request/ # send a pipeline input to the API to start running REQJSON:=fixtures/tests/run_roslin.json run-request-api: $(AUTH_FILE) - @token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ + token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ + echo ">>> token: $$token" && \ curl -H "Content-Type: application/json" \ -X POST \ -H "Authorization: Bearer $$token" \ --data @$(REQJSON) \ http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/run/api/ +# http://localhost:6991/v0/run/api/?metadata=requestId:10277_C +# http://localhost:6991/v0/run/api/?requestId%3D10277_C/ # make a demo Roslin input.json file from the template fixture; # need to update the fixture with the app ID of the demo pipeline that was loaded in the database @@ -473,6 +479,15 @@ demo-run: register-dev-pipeline $(DEMO_INPUT) @python manage.py loaddata fixtures/tests/roslin_reference_files.json @$(MAKE) run-request-api REQID=DemoRequest1 REQJSON=$(DEMO_INPUT) +# run the update-request endpoint for a request ID in order to update the metadata about a request +update-request: + @token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ + curl -H "Content-Type: application/json" \ + -X POST \ + -H "Authorization: Bearer $$token" \ + --data '{"request_ids":["$(REQID)"], "pipeline_name": "roslin"}' \ + http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/etl/update-requests/ + # check if the ports needed for services and servers are already in use on this system ifeq ($(UNAME), Darwin) # On macOS High Sierra, use this command: lsof -nP -i4TCP:$PORT | grep LISTEN diff --git a/fixtures/tests/juno_roslin_demo2.pipeline_input.json b/fixtures/tests/juno_roslin_demo2.pipeline_input.json index bec1a85bd..6c61f7e56 100644 --- a/fixtures/tests/juno_roslin_demo2.pipeline_input.json +++ b/fixtures/tests/juno_roslin_demo2.pipeline_input.json @@ -310,10 +310,16 @@ "PU": [ ], "R1": [ - "/juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz" + { + "class": "File", + "location": "juno:///juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz" + } ], "R2": [ - "/juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz" + { + "class": "File", + "location": "juno:///juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz" + } ], "bam": [], "zR1": [], @@ -332,10 +338,16 @@ "PU": [ ], "R1": [ - "/juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz" + { + "class": "File", + "location": "juno:///juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz" + } ], "R2": [ - "/juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz" + { + "class": "File", + "location": "juno:///juno/work/ci/roslin-pipelines/variant/2.6.0/workspace/test_data/examples/data/fastq/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz" + } ], "bam": [], "zR1": [], From 33a8c195afaa28e6e2afd7c202b050c56717f75d Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Sat, 15 Feb 2020 18:39:21 -0500 Subject: [PATCH 07/31] add fixture duplication script --- scripts/duplicate_fixtures.py | 161 ++++++++++++++++++++++++++++++++++ 1 file changed, 161 insertions(+) create mode 100755 scripts/duplicate_fixtures.py diff --git a/scripts/duplicate_fixtures.py b/scripts/duplicate_fixtures.py new file mode 100755 index 000000000..e1454a3ec --- /dev/null +++ b/scripts/duplicate_fixtures.py @@ -0,0 +1,161 @@ +#!/usr/bin/env python +# -*- coding: utf-8 -*- +""" +Script to use for creating a modified, non-conflicting duplicate of an existing database fixture +Use this after you have dumped some fixtures to a .json file using `dump_db_fixtures.py`, and now you +want another fixture set that has different UUIDs and identifiers so you can load both at once in a dev database +in order to get work done with them. + +Input: .json file produced by dump_db_fixtures.py + +Output: a new .json file with updated key values + +Usage +----- + ./duplicate_fixtures.py ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json + +Notes +----- +The input .json file must have been produced with 'indent = 4' or have equivalent indenting, or this script will probably not work +""" +import sys +import json +import uuid +import copy +import re +import time + +def get_unique_id(): + """ + Get a unique ID + maybe replace with with uuid4? + uuid1 has a lower chance of duplicate id's being generated + + TODO: see what Sinisa thinks about this later + """ + return(uuid.uuid1()) + +def replace_primary_keys(input_file): + """ + Replaces all primary keys in the file with new values + """ + # get all primary keys that need to be changed + all_pk = [] + with open(input_file) as f: + for item in json.load(f): + all_pk.append(item['pk']) + + # sort unique based on descending length + # this makes sure we replace the longer pattern first in the next steps + all_pk = sorted(list(set(all_pk)), key = len, reverse=True) + + # load all lines of text from the file + lines = open(input_file).readlines() + + # make a copy for editing + output_lines = copy.deepcopy(lines) + + editted_lines = [] + + # search for every primary key in every line of text ... !! Yes, we are doing this + for old_pk in all_pk: + new_pk = str(get_unique_id()) + for i, old_line in enumerate(lines): + if old_pk in old_line: + # I think this only replaces first intance of the pattern? shouldnt matter for this if you printed JSON with indent = 4 + new_line = re.sub(old_pk, new_pk, output_lines[i]) + output_lines[i] = new_line + + # each line should only get editted one time doing this otherwise something is wrong + if i not in editted_lines: + editted_lines.append(i) + else: + print("ERROR: line {} is about to get editted twice; that is not supposed to happen something is wrong".format(i)) + raise + return(output_lines) + +def get_field_values(input_lines, field_name): + """ + Finds a list of all unique values for a given field in the file lines + + examples: + + "runId": "PITT_0390", + >>> ["PITT_0390"] + + "requestId": "09670_D_1581808018", + "sampleId": "09670_D_1", + "patientId": "C-K2902H", + "sampleName": "C-K2902H-P001-d", + "externalSampleId": "S16-68609", + "investigatorSampleId": "S16-68609", + """ + all_values = set() + search_pattern = '.*"{field_name}": "(.*)"'.format(field_name = field_name) + for line in input_lines: + match = re.search(search_pattern, line) + if match != None: + value = match.group(1) + all_values.add(value) + + # return reverse sorted on length to ensure sub-patterns do not get replaced first later + all_values = sorted(list(set(all_values)), key = len, reverse=True) + return(all_values) + +def replace_field_value(input_lines, field_name, old_value, new_value): + """ + Replace the old value for a field with the new value in all file lines + """ + # make a copy for editing + output_lines = copy.deepcopy(input_lines) + + fieldname_search_pattern = '"{field_name}":'.format(field_name = field_name) + + # search for the field label in all lines and replace the value if found + for i, line in enumerate(input_lines): + # check that its a line with the desired field name in it + line_match = re.search(fieldname_search_pattern, line) + if line_match != None: + # check that the desired value to be changed is present + id_match = re.search(old_value, line) + if id_match != None: + # replace the old value with the new value + new_line = re.sub(old_value, new_value, output_lines[i]) + output_lines[i] = new_line + return(output_lines) + +def main(input_file): + """ + Main function for editing a fixtures file to replace all old primary keys with new keys + So that both old and new fixtures sets can be loaded into the database at the same time + """ + output_file_name = "{}.duplicated.json".format(input_file) + + # generate a timestamp string to use for new unique identifiers + timestamp_str = str(int(time.time())) + + # replace all the primary keys with new values; need special handling for pk's because they do not always have a field label in the file + output_lines = replace_primary_keys(input_file) + + # replace the values for all of these other desired fields; these fields are always clearly labeled in the file so they are easy to find + for field_name in ['runId', 'requestId', 'sampleId', 'patientId', 'sampleName', 'externalSampleId', 'investigatorSampleId']: + all_values = get_field_values(input_lines = output_lines, field_name = field_name) + for old_value in all_values: + # make a new value by appending the timestamp + new_value = old_value + '_' + timestamp_str + output_lines = replace_field_value(input_lines = output_lines, field_name = field_name, old_value = old_value, new_value = new_value) + + # save the output files + with open(output_file_name, "w") as fout: + fout.writelines(output_lines) + +def parse(): + """ + Parses script args + Script arg parsing will go here as this script grows + """ + input_file = sys.argv[1] + main(input_file) + +if __name__ == '__main__': + parse() From d452748e95d06a8c1fbe5ad31e0fb61c651f3435 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Sun, 16 Feb 2020 14:12:13 -0500 Subject: [PATCH 08/31] add multiple run handling for roslin qc input, update fixtures and scripts --- ...-50ea-11ea-b9c7-ac1f6b453620.run.full.json | 6854 +++++++++++++++++ .../operator/roslin_qc_operator/bin/input.py | 53 +- .../operator/roslin_qc_operator/test_input.py | 50 +- scripts/dump_db_fixtures.py | 12 + scripts/duplicate_fixtures.py | 55 +- 5 files changed, 7007 insertions(+), 17 deletions(-) create mode 100644 fixtures/tests/daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json diff --git a/fixtures/tests/daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json b/fixtures/tests/daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json new file mode 100644 index 000000000..9fc6836a6 --- /dev/null +++ b/fixtures/tests/daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json @@ -0,0 +1,6854 @@ +[ + { + "model": "runner.run", + "pk": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:02.012Z", + "modified_date": "2020-01-14T23:03:35.530Z", + "name": "ROSLIN 09670_D, 22 of 54 (12/11/2019, 22:53:02)", + "app": "cb5d793b-e650-4b7d-bfcd-882858e29cc5", + "status": 4, + "execution_id": "df43cc77-bed4-4233-9817-6d12e25d9e1c", + "job_statuses": {}, + "output_metadata": { + "assay": "IDT_Exome_v1_FP_b37" + }, + "tags": { + "requestId": "09670_D_1581878020" + } + } + }, + { + "model": "runner.port", + "pk": "dabf34dc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.822Z", + "modified_date": "2020-02-04T15:29:30.720Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "dbsnp", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://dabdfd38-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.1581878020.vcf", + "size": 2432705678, + "class": "File" + }, + "files": [ + "dabdfd38-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab4dad2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.827Z", + "modified_date": "2020-02-04T15:29:30.724Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "indels_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://dab3905a-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.1581878020.vcf", + "size": 86369975, + "class": "File" + }, + "files": [ + "dab3905a-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab54634-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.831Z", + "modified_date": "2020-02-04T15:29:30.750Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "snps_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://daa1a6d8-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.1581878020.vcf", + "size": 7313069069, + "class": "File" + }, + "files": [ + "daa1a6d8-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daceaa7a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.836Z", + "modified_date": "2020-02-04T15:29:30.924Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "cosmic", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://daad9ff6-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.1581878020.vcf", + "size": 112402812, + "class": "File" + }, + "files": [ + "daad9ff6-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab8acb6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.843Z", + "modified_date": "2020-02-04T15:29:31.049Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "exac_filter", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "class": "File", + "location": "bid://dab5fed0-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.1581878020.gz", + "size": 337197976, + "class": "File" + }, + "files": [ + "dab5fed0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daaee9ce-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.802Z", + "modified_date": "2020-02-04T15:29:52.626Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "db_files", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "refseq": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "vep_data": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "vep_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "custom_enst": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_snps": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_vcf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "fp_genotypes": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "fp_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_list": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_exclude": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "bait_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "hotspot_list_maf": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "target_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers_bed": { + "type": [ + "null", + "array" + ], + "items": "string" + } + } + }, + "secondary_files": [], + "db_value": { + "refseq": { + "class": "File", + "location": "bid://dac9d9c8-50ea-11ea-b9c7-ac1f6b453620" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "class": "File", + "location": "bid://dab111c2-50ea-11ea-b9c7-ac1f6b453620" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "class": "File", + "location": "bid://dac595d4-50ea-11ea-b9c7-ac1f6b453620" + }, + "fp_intervals": { + "class": "File", + "location": "bid://daa96544-50ea-11ea-b9c7-ac1f6b453620" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "class": "File", + "location": "bid://daa7b032-50ea-11ea-b9c7-ac1f6b453620" + }, + "bait_intervals": { + "class": "File", + "location": "bid://daced162-50ea-11ea-b9c7-ac1f6b453620" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "class": "File", + "location": "bid://dab3b580-50ea-11ea-b9c7-ac1f6b453620" + }, + "target_intervals": { + "class": "File", + "location": "bid://daa0f882-50ea-11ea-b9c7-ac1f6b453620" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "value": { + "refseq": { + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.1581878020.txt", + "size": 9953757, + "class": "File" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.1581878020.gz", + "size": 1015019014, + "class": "File" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.1581878020.txt", + "size": 38179, + "class": "File" + }, + "fp_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_intervals.1581878020.intervals", + "size": 50804, + "class": "File" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.1581878020.tsv", + "size": 6984, + "class": "File" + }, + "bait_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_baits.1581878020.ilist", + "size": 7083292, + "class": "File" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.1581878020.maf", + "size": 624846, + "class": "File" + }, + "target_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_targets.1581878020.ilist", + "size": 6997415, + "class": "File" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "files": [ + "dac595d4-50ea-11ea-b9c7-ac1f6b453620", + "dac9d9c8-50ea-11ea-b9c7-ac1f6b453620", + "dab111c2-50ea-11ea-b9c7-ac1f6b453620", + "dab3b580-50ea-11ea-b9c7-ac1f6b453620", + "daced162-50ea-11ea-b9c7-ac1f6b453620", + "daa96544-50ea-11ea-b9c7-ac1f6b453620", + "daa0f882-50ea-11ea-b9c7-ac1f6b453620", + "daa7b032-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac67260-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.852Z", + "modified_date": "2020-02-04T15:29:52.795Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "curated_bams", + "port_type": 0, + "schema": { + "type": "array", + "items": [ + "null", + "array" + ] + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "class": "File", + "location": "bid://dac975dc-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabb1d34-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab569fc-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab96020-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dacb2198-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa7ddaa-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daad53d4-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dac91556-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab98686-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabdb3aa-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daad1f18-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://da9de9b2-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab1cb76-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab5b524-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab46df4-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab31efe-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dacefc1e-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa1dc98-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab3db5a-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabb66b8-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa83930-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabc433a-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://da9e6d7e-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa5b7a0-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dab1f13c-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dac14e20-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dabcb4aa-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dac8139a-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa86414-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa6730c-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://da9f2480-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa3ffdc-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daa8e420-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dac20b94-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://dacf4ff2-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daac8620-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daaec3b8-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daac3936-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://da9f6166-50ea-11ea-b9c7-ac1f6b453620" + }, + { + "class": "File", + "location": "bid://daaf0d5a-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "value": [ + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006284_N002_d.Group3.rg.md.abra.printreads.1581878020.bam", + "size": 18001309333, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006537_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 13424642344, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006550_N002_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 13851651891, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006609_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 16764556278, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006610_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 17797687748, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006626_N001_d.Group19.rg.md.abra.printreads.1581878020.bam", + "size": 15450048427, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006627_N001_d.Group20.rg.md.abra.printreads.1581878020.bam", + "size": 21418934197, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006628_N001_d.Group15.rg.md.abra.printreads.1581878020.bam", + "size": 20242506560, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006630_N001_d.Group14.rg.md.abra.printreads.1581878020.bam", + "size": 18554952981, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006631_N001_d.Group17.rg.md.abra.printreads.1581878020.bam", + "size": 17671380235, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006632_N001_d.Group16.rg.md.abra.printreads.1581878020.bam", + "size": 17956822592, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006633_N001_d.Group13.rg.md.abra.printreads.1581878020.bam", + "size": 14995930592, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006635_N001_d.Group8.rg.md.abra.printreads.1581878020.bam", + "size": 19452196435, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006636_N001_d.Group9.rg.md.abra.printreads.1581878020.bam", + "size": 19189450319, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006637_N002_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 10888838079, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006638_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 10088003650, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006639_N001_d.Group6.rg.md.abra.printreads.1581878020.bam", + "size": 18437335538, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006640_N001_d.Group7.rg.md.abra.printreads.1581878020.bam", + "size": 18781758639, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006641_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "size": 15954753147, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006642_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "size": 17579506808, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006643_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "size": 17298827865, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006644_N001_d.Group3.rg.md.abra.printreads.1581878020.bam", + "size": 19302206744, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006645_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 15523622669, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006646_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 17007314582, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006647_N001_d.Group18.rg.md.abra.printreads.1581878020.bam", + "size": 20776680414, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006648_N001_d.Group11.rg.md.abra.printreads.1581878020.bam", + "size": 17232710261, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006649_N001_d.Group10.rg.md.abra.printreads.1581878020.bam", + "size": 17366153538, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006650_N001_d.Group21.rg.md.abra.printreads.1581878020.bam", + "size": 16571180154, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006904_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 18185638557, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006905_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 18558003865, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006906_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 16951748171, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006907_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 16389279357, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006996_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 10690676737, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 13862649385, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 11105358516, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "size": 17582103301, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "size": 19349236927, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "size": 20668078544, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "size": 18873117772, + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "size": 19501528278, + "class": "File" + } + ], + "files": [ + "dab569fc-50ea-11ea-b9c7-ac1f6b453620", + "daad53d4-50ea-11ea-b9c7-ac1f6b453620", + "dab3db5a-50ea-11ea-b9c7-ac1f6b453620", + "dac91556-50ea-11ea-b9c7-ac1f6b453620", + "dac20b94-50ea-11ea-b9c7-ac1f6b453620", + "daad1f18-50ea-11ea-b9c7-ac1f6b453620", + "dabb1d34-50ea-11ea-b9c7-ac1f6b453620", + "dab96020-50ea-11ea-b9c7-ac1f6b453620", + "daa5b7a0-50ea-11ea-b9c7-ac1f6b453620", + "daaf0d5a-50ea-11ea-b9c7-ac1f6b453620", + "dacb2198-50ea-11ea-b9c7-ac1f6b453620", + "dab46df4-50ea-11ea-b9c7-ac1f6b453620", + "daa86414-50ea-11ea-b9c7-ac1f6b453620", + "dabdb3aa-50ea-11ea-b9c7-ac1f6b453620", + "daa8e420-50ea-11ea-b9c7-ac1f6b453620", + "dab98686-50ea-11ea-b9c7-ac1f6b453620", + "dacf4ff2-50ea-11ea-b9c7-ac1f6b453620", + "daa3ffdc-50ea-11ea-b9c7-ac1f6b453620", + "dab1f13c-50ea-11ea-b9c7-ac1f6b453620", + "daa83930-50ea-11ea-b9c7-ac1f6b453620", + "daac3936-50ea-11ea-b9c7-ac1f6b453620", + "dac975dc-50ea-11ea-b9c7-ac1f6b453620", + "daac8620-50ea-11ea-b9c7-ac1f6b453620", + "dab31efe-50ea-11ea-b9c7-ac1f6b453620", + "da9e6d7e-50ea-11ea-b9c7-ac1f6b453620", + "dabc433a-50ea-11ea-b9c7-ac1f6b453620", + "dac14e20-50ea-11ea-b9c7-ac1f6b453620", + "da9de9b2-50ea-11ea-b9c7-ac1f6b453620", + "daa1dc98-50ea-11ea-b9c7-ac1f6b453620", + "da9f6166-50ea-11ea-b9c7-ac1f6b453620", + "dacefc1e-50ea-11ea-b9c7-ac1f6b453620", + "dabb66b8-50ea-11ea-b9c7-ac1f6b453620", + "dab5b524-50ea-11ea-b9c7-ac1f6b453620", + "dac8139a-50ea-11ea-b9c7-ac1f6b453620", + "daa6730c-50ea-11ea-b9c7-ac1f6b453620", + "daaec3b8-50ea-11ea-b9c7-ac1f6b453620", + "daa7ddaa-50ea-11ea-b9c7-ac1f6b453620", + "dab1cb76-50ea-11ea-b9c7-ac1f6b453620", + "da9f2480-50ea-11ea-b9c7-ac1f6b453620", + "dabcb4aa-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac7e294-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.808Z", + "modified_date": "2020-02-04T15:29:52.632Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "ref_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://dabd44b0-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.1581878020.fasta", + "size": 3189750467, + "class": "File" + }, + "files": [ + "dabd44b0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dacfa4c0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.814Z", + "modified_date": "2020-02-04T15:29:52.640Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "mouse_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://daaf32ee-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.1581878020.fasta", + "size": 2769885087, + "class": "File" + }, + "files": [ + "daaf32ee-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "da9e2d64-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.818Z", + "modified_date": "2020-02-04T15:29:52.648Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "hapmap", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://dabd69fe-50ea-11ea-b9c7-ac1f6b453620" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.1581878020.vcf", + "size": 225898391, + "class": "File" + }, + "files": [ + "dabd69fe-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa3cd78-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.862Z", + "modified_date": "2020-02-04T15:29:52.797Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "runparams", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "genome": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "tmp_dir": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "intervals": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "mutect_rf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "complex_nn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "complex_tn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "covariates": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_type": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_cval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "mutect_dcov": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "num_threads": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "scripts_bin": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "abra_ram_min": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "abra_scratch": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_pcval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "gatk_jar_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "project_prefix": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "opt_dup_pix_dist": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "emit_original_quals": { + "type": [ + "null", + "array" + ], + "items": "boolean" + }, + "num_cpu_threads_per_data_thread": { + "type": [ + "null", + "array" + ], + "items": "int" + } + } + }, + "secondary_files": [], + "db_value": { + "genome": "GRCh37", + "tmp_dir": "/scratch", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.1, + "complex_tn": 0.2, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 100, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/scratch", + "facets_pcval": 500, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": [ + "09670_D" + ], + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "value": { + "genome": "GRCh37", + "tmp_dir": "/scratch", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.1, + "complex_tn": 0.2, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 100, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/scratch", + "facets_pcval": 500, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": [ + "09670_D" + ], + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "files": [] + } + }, + { + "model": "runner.port", + "pk": "dab2faaa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.869Z", + "modified_date": "2020-02-04T15:29:52.810Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "pair", + "port_type": 0, + "schema": { + "type": "array", + "items": "record" + }, + "secondary_files": [], + "db_value": [ + { + "CN": "MSKCC", + "ID": "s_C_K2902H_P001_d", + "LB": "09670_D_1_1_1_1_1", + "PL": "Illumina", + "PU": [ + "H7HCTBBXY_ACATACGG" + ], + "R1": [ + { + "class": "File", + "location": "bid://dabbf808-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://daad7a4e-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_P001_d_H7HCTBBXY_ACATACGG" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_P001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_K2902H_N001_d", + "LB": "09670_D_46_1", + "PL": "Illumina", + "PU": [ + "H7FKJBBXY" + ], + "R1": [ + { + "class": "File", + "location": "bid://dacc897a-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://dab2170c-50ea-11ea-b9c7-ac1f6b453620" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_N001_d_H7FKJBBXY" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_N001_d.bam" + } + ], + "value": [ + { + "CN": "MSKCC", + "ID": "s_C_K2902H_P001_d", + "LB": "09670_D_1_1_1_1_1", + "PL": "Illumina", + "PU": [ + "H7HCTBBXY_ACATACGG" + ], + "R1": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.1581878020.gz", + "size": 5966546453, + "class": "File" + } + ], + "R2": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.1581878020.gz", + "size": 5832468368, + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_P001_d_H7HCTBBXY_ACATACGG" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_P001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_K2902H_N001_d", + "LB": "09670_D_46_1", + "PL": "Illumina", + "PU": [ + "H7FKJBBXY" + ], + "R1": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.1581878020.gz", + "size": 3576965127, + "class": "File" + } + ], + "R2": [ + { + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.1581878020.gz", + "size": 3592299152, + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_K2902H_N001_d_H7FKJBBXY" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_K2902H_N001_d.bam" + } + ], + "files": [ + "daad7a4e-50ea-11ea-b9c7-ac1f6b453620", + "dabbf808-50ea-11ea-b9c7-ac1f6b453620", + "dab2170c-50ea-11ea-b9c7-ac1f6b453620", + "dacc897a-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daab50d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.971Z", + "modified_date": "2020-02-04T15:29:58.827Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "annotate_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 65612975, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "checksum": "sha1$0201d57f5fd370615df7ce8b78f49ae512692e0e", + "location": "bid://dab424ca-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants" + }, + "value": { + "size": 65612975, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "checksum": "sha1$0201d57f5fd370615df7ce8b78f49ae512692e0e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants" + }, + "files": [ + "dab424ca-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daca9804-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.030Z", + "modified_date": "2020-02-04T15:29:59.003Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "maf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 181310718, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "checksum": "sha1$15db27138a1586bf4f017b572154875c5ff129db", + "location": "bid://dacd0954-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts" + }, + "value": { + "size": 181310718, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "checksum": "sha1$15db27138a1586bf4f017b572154875c5ff129db", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.maf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts" + }, + "files": [ + "dacd0954-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa6cdac-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.873Z", + "modified_date": "2020-02-04T15:29:59.010Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "bams", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "size": 22899967017, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$d67cf2c24cacfeaa222893c5d4303aed55556457", + "location": "bid://daba66aa-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6252264, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$776fc843bcdbd215452e611f03d7d9b42ad05a09", + "location": "bid://a0184edc-0a1c-40e7-9d41-69dda2e1e23e", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads" + } + ] + }, + { + "size": 14961505727, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$45f52cc5db96a9d90784ddcee324cedbe1ac5618", + "location": "bid://dab07dc0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6010352, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$67a9aff1f1cd7be0240b7fefe740f7852dee4933", + "location": "bid://12ffa7a4-b853-452d-8076-fde5bac09aec", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads" + } + ] + } + ], + "value": [ + { + "size": 22899967017, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$d67cf2c24cacfeaa222893c5d4303aed55556457", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6252264, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$776fc843bcdbd215452e611f03d7d9b42ad05a09", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads" + } + ] + }, + { + "size": 14961505727, + "class": "File", + "nameext": ".bam", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$45f52cc5db96a9d90784ddcee324cedbe1ac5618", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 6010352, + "class": "File", + "nameext": ".bai", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$67a9aff1f1cd7be0240b7fefe740f7852dee4933", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads" + } + ] + } + ], + "files": [ + "daba66aa-50ea-11ea-b9c7-ac1f6b453620", + "dab07dc0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac5d0f8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.876Z", + "modified_date": "2020-02-04T15:29:59.025Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "clstats1", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2641, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "checksum": "sha1$c3c14c67c47c1a9502a528685d8f24f1eda9dccd", + "location": "bid://daa90ff4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl" + }, + { + "size": 2611, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "checksum": "sha1$15260c3f7d8a521e7d2021f2581f8ffd96ff9519", + "location": "bid://dac27a66-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl" + }, + { + "size": 2576, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "checksum": "sha1$ef853b586f31afefcabe8be9ba28bcddd5e47919", + "location": "bid://dab05854-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl" + } + ], + [ + { + "size": 2764, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "checksum": "sha1$581103c999b49f012af12d4dd579a48ab7573991", + "location": "bid://daab79ba-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl" + }, + { + "size": 2714, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "checksum": "sha1$fe2dd352e11bc48feefc6f7e1035ea0b5c8265dc", + "location": "bid://daa9905a-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl" + } + ] + ], + "value": [ + [ + { + "size": 2641, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "checksum": "sha1$c3c14c67c47c1a9502a528685d8f24f1eda9dccd", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl" + }, + { + "size": 2611, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "checksum": "sha1$15260c3f7d8a521e7d2021f2581f8ffd96ff9519", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl" + }, + { + "size": 2576, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "checksum": "sha1$ef853b586f31afefcabe8be9ba28bcddd5e47919", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl" + } + ], + [ + { + "size": 2764, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "checksum": "sha1$581103c999b49f012af12d4dd579a48ab7573991", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl" + }, + { + "size": 2714, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "checksum": "sha1$fe2dd352e11bc48feefc6f7e1035ea0b5c8265dc", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl" + } + ] + ], + "files": [ + "daa90ff4-50ea-11ea-b9c7-ac1f6b453620", + "daa9905a-50ea-11ea-b9c7-ac1f6b453620", + "daab79ba-50ea-11ea-b9c7-ac1f6b453620", + "dab05854-50ea-11ea-b9c7-ac1f6b453620", + "dac27a66-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daafc5b0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.879Z", + "modified_date": "2020-02-04T15:29:59.042Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "clstats2", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2818, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "checksum": "sha1$883cf9ba173211144550938349dfdbeefb6f38ee", + "location": "bid://dabaafca-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl" + }, + { + "size": 2815, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "checksum": "sha1$78e3a8aab3b20c83dee40acea967e25893ec2065", + "location": "bid://dab3444c-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl" + }, + { + "size": 2775, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "checksum": "sha1$83cee0ca80ff374fd6049f9cbf475fb81a380d91", + "location": "bid://dacfcb44-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl" + } + ], + [ + { + "size": 2873, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "checksum": "sha1$2f9093a15e3a538e80653637690e0410779df620", + "location": "bid://dacba802-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl" + }, + { + "size": 2826, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "checksum": "sha1$e583971745676ccfbbb0b09474f74ecef10ea922", + "location": "bid://dabed8d4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl" + } + ] + ], + "value": [ + [ + { + "size": 2818, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "checksum": "sha1$883cf9ba173211144550938349dfdbeefb6f38ee", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl" + }, + { + "size": 2815, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "checksum": "sha1$78e3a8aab3b20c83dee40acea967e25893ec2065", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl" + }, + { + "size": 2775, + "class": "File", + "nameext": ".stats", + "basename": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "checksum": "sha1$83cee0ca80ff374fd6049f9cbf475fb81a380d91", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.stats", + "nameroot": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl" + } + ], + [ + { + "size": 2873, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "checksum": "sha1$2f9093a15e3a538e80653637690e0410779df620", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl" + }, + { + "size": 2826, + "class": "File", + "nameext": ".stats", + "basename": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "checksum": "sha1$e583971745676ccfbbb0b09474f74ecef10ea922", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.stats", + "nameroot": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl" + } + ] + ], + "files": [ + "dabed8d4-50ea-11ea-b9c7-ac1f6b453620", + "dacba802-50ea-11ea-b9c7-ac1f6b453620", + "dab3444c-50ea-11ea-b9c7-ac1f6b453620", + "dacfcb44-50ea-11ea-b9c7-ac1f6b453620", + "dabaafca-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac87ab0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.020Z", + "modified_date": "2020-02-04T15:29:59.046Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "maf_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 59073, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "checksum": "sha1$bc1d7f73cc72eecf3b13f88402d6952c92d933de", + "location": "bid://dab17ef0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep" + }, + "value": { + "size": 59073, + "class": "File", + "nameext": ".maf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "checksum": "sha1$bc1d7f73cc72eecf3b13f88402d6952c92d933de", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.maf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep" + }, + "files": [ + "dab17ef0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab2d71e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.932Z", + "modified_date": "2020-02-04T15:29:59.053Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "qual_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8189, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$9ff5ad812b693a79512b12506f59d5d67df87c05", + "location": "bid://da9eab36-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8219, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$716fb1c1bcd8040ecc6e4452cbbae25a20435c52", + "location": "bid://dab62496-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "value": [ + { + "size": 8189, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$9ff5ad812b693a79512b12506f59d5d67df87c05", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8219, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$716fb1c1bcd8040ecc6e4452cbbae25a20435c52", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "files": [ + "da9eab36-50ea-11ea-b9c7-ac1f6b453620", + "dab62496-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab8d01a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.892Z", + "modified_date": "2020-02-04T15:29:59.059Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "as_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2171, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.asmetrics", + "checksum": "sha1$7e891f9f68deedb83626c728109097d9c562f7a1", + "location": "bid://dac1cad0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 2134, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.asmetrics", + "checksum": "sha1$65ab3f206ead19b7ae3aa0eb4a9d1c5e7dff9843", + "location": "bid://dab8f3f6-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 2171, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.asmetrics", + "checksum": "sha1$7e891f9f68deedb83626c728109097d9c562f7a1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.asmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 2134, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.asmetrics", + "checksum": "sha1$65ab3f206ead19b7ae3aa0eb4a9d1c5e7dff9843", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.asmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "dab8f3f6-50ea-11ea-b9c7-ac1f6b453620", + "dac1cad0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab7f9ec-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.997Z", + "modified_date": "2020-02-04T15:29:59.066Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_out", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 603, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$adf1df0bad06a20de898606152b4562d13de5fba", + "location": "bid://daacadd0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 602, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$f376bc7c0c427199a8319cbe95fc368abc914535", + "location": "bid://daaa358c-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 603, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$adf1df0bad06a20de898606152b4562d13de5fba", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.out", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 602, + "class": "File", + "nameext": ".out", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$f376bc7c0c427199a8319cbe95fc368abc914535", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.out", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "daacadd0-50ea-11ea-b9c7-ac1f6b453620", + "daaa358c-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab0ed96-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.986Z", + "modified_date": "2020-02-04T15:29:59.077Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_png", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 124853, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$aa3cfccae19203ef9fa352574ecdbf8db6b42d5a", + "location": "bid://daae0d88-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 111084, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$dd13091946cb9b1ae3c002c0b86f8c1ca8f7bdea", + "location": "bid://daaaaf62-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "value": [ + { + "size": 124853, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$aa3cfccae19203ef9fa352574ecdbf8db6b42d5a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.png", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 111084, + "class": "File", + "nameext": ".png", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$dd13091946cb9b1ae3c002c0b86f8c1ca8f7bdea", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.png", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "files": [ + "daaaaf62-50ea-11ea-b9c7-ac1f6b453620", + "daae0d88-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dabdd952-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.005Z", + "modified_date": "2020-02-04T15:29:59.084Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_seg", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 4777, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$31d0a6687ac647922e9d67a0d2d6a28a7e16ec7a", + "location": "bid://dac746b8-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 3222, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$d15b1f7136fb9d107297f35abffd2ee9c9a229ac", + "location": "bid://daaa865e-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 4777, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$31d0a6687ac647922e9d67a0d2d6a28a7e16ec7a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.seg", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 3222, + "class": "File", + "nameext": ".seg", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$d15b1f7136fb9d107297f35abffd2ee9c9a229ac", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.seg", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "dac746b8-50ea-11ea-b9c7-ac1f6b453620", + "daaa865e-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daccb562-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.939Z", + "modified_date": "2020-02-04T15:29:59.091Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "gcbias_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6784, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "checksum": "sha1$4d1ed6c4bda99d26a031b9e9651f2f4abe8cfdd2", + "location": "bid://dac63ac0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 6794, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "checksum": "sha1$010c3e9323875594fa4d4469c13b91db5a46e8cc", + "location": "bid://daa6f9b2-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "value": [ + { + "size": 6784, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "checksum": "sha1$4d1ed6c4bda99d26a031b9e9651f2f4abe8cfdd2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 6794, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "checksum": "sha1$010c3e9323875594fa4d4469c13b91db5a46e8cc", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "files": [ + "daa6f9b2-50ea-11ea-b9c7-ac1f6b453620", + "dac63ac0-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dacff34e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.897Z", + "modified_date": "2020-02-04T15:29:59.098Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "hs_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5016, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "checksum": "sha1$d6ba79849a45f9fa69092453ada9f5992e7c0abb", + "location": "bid://daa754ac-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 5029, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "checksum": "sha1$2b08239d16dc6787ab37a7403313d46264877c7e", + "location": "bid://dab9ac60-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 5016, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hsmetrics", + "checksum": "sha1$d6ba79849a45f9fa69092453ada9f5992e7c0abb", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.hsmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 5029, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hsmetrics", + "checksum": "sha1$2b08239d16dc6787ab37a7403313d46264877c7e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.hsmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "daa754ac-50ea-11ea-b9c7-ac1f6b453620", + "dab9ac60-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac84914-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.920Z", + "modified_date": "2020-02-04T15:29:59.105Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "insert_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 13994, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$aa4d306c3b2327fe6e84ebf6b371ca79644ec649", + "location": "bid://dac340f4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.ismetrics" + }, + { + "size": 12712, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$5a57d43594e74ac8615409802377346f212e1cf7", + "location": "bid://dacf7a18-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.ismetrics" + } + ], + "value": [ + { + "size": 13994, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$aa4d306c3b2327fe6e84ebf6b371ca79644ec649", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_K2902H_P001_d.rg.md.ismetrics" + }, + { + "size": 12712, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$5a57d43594e74ac8615409802377346f212e1cf7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_K2902H_N001_d.rg.md.ismetrics" + } + ], + "files": [ + "dacf7a18-50ea-11ea-b9c7-ac1f6b453620", + "dac340f4-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac110fe-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.884Z", + "modified_date": "2020-02-04T15:29:59.117Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "md_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2900, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_P001_d.rg.md_metrics", + "checksum": "sha1$379ec0abb55e3b1ff9adb8ff82ed31689aa8062b", + "location": "bid://dab36a62-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg" + }, + { + "size": 2866, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_N001_d.rg.md_metrics", + "checksum": "sha1$d2005e5e85d9e581671522c74548c8623d2c1979", + "location": "bid://daafe950-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg" + } + ], + "value": [ + { + "size": 2900, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_P001_d.rg.md_metrics", + "checksum": "sha1$379ec0abb55e3b1ff9adb8ff82ed31689aa8062b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md_metrics", + "nameroot": "s_C_K2902H_P001_d.rg" + }, + { + "size": 2866, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_K2902H_N001_d.rg.md_metrics", + "checksum": "sha1$d2005e5e85d9e581671522c74548c8623d2c1979", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md_metrics", + "nameroot": "s_C_K2902H_N001_d.rg" + } + ], + "files": [ + "daafe950-50ea-11ea-b9c7-ac1f6b453620", + "dab36a62-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab93cb2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.956Z", + "modified_date": "2020-02-04T15:29:59.121Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "mutect_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 24213327, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$dc5d1aeb90cee217d736222d2dada308973832d6", + "location": "bid://dac43b26-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "value": { + "size": 24213327, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$dc5d1aeb90cee217d736222d2dada308973832d6", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.vcf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "dac43b26-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac94652-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.968Z", + "modified_date": "2020-02-04T15:29:59.125Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "combine_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 13440159, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "checksum": "sha1$11cb5a6370052fdfb1d83da53a7161cf3592e8f5", + "location": "bid://dac9a854-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 430453, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$dd9315feeb320ec777dac7297b3a9bfc7a5d6c33", + "location": "bid://ae7708c1-6e92-480b-a550-5c847056e0ca", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz" + } + ] + }, + "value": { + "size": 13440159, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "checksum": "sha1$11cb5a6370052fdfb1d83da53a7161cf3592e8f5", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 430453, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$dd9315feeb320ec777dac7297b3a9bfc7a5d6c33", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.gz" + } + ] + }, + "files": [ + "dac9a854-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daba4314-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.014Z", + "modified_date": "2020-02-04T15:29:59.129Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "merged_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 19739, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "checksum": "sha1$c016b28102cd0e828dda14b1dfca985f822849ed", + "location": "bid://dab00e76-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass" + }, + "value": { + "size": 19739, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "checksum": "sha1$c016b28102cd0e828dda14b1dfca985f822849ed", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass" + }, + "files": [ + "dab00e76-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab5dad6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.026Z", + "modified_date": "2020-02-04T15:29:59.133Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "portal_file", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 5795, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "checksum": "sha1$14d8ca3da33d4d318fa5f5e2cdf77f8687a62148", + "location": "bid://dac8e07c-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal" + }, + "value": { + "size": 5795, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "checksum": "sha1$14d8ca3da33d4d318fa5f5e2cdf77f8687a62148", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.txt", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal" + }, + "files": [ + "dac8e07c-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dabaf9bc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.965Z", + "modified_date": "2020-02-04T15:29:59.137Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "vardict_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 403491742, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$cbcd1bd27821f1c527434bfe9abace8d3320819e", + "location": "bid://dab0c884-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict" + }, + "value": { + "size": 403491742, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$cbcd1bd27821f1c527434bfe9abace8d3320819e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.vcf", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict" + }, + "files": [ + "dab0c884-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab7224c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.003Z", + "modified_date": "2020-02-04T15:29:59.147Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_rdata", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8622126, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$1e47fce47992626a03fe84ebcb3e95a0fecea4f1", + "location": "bid://daa9bb7a-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 8618530, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$b990bfe8c0471672e76056a0f291b5d4ee81d4d9", + "location": "bid://dab9d2c6-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "value": [ + { + "size": 8622126, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$1e47fce47992626a03fe84ebcb3e95a0fecea4f1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.Rdata", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 8618530, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$b990bfe8c0471672e76056a0f291b5d4ee81d4d9", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.Rdata", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "daa9bb7a-50ea-11ea-b9c7-ac1f6b453620", + "dab9d2c6-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dad01996-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.928Z", + "modified_date": "2020-02-04T15:29:59.154Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "qual_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5494, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$dad5640a5406c875b7fdaf4103b6edc2f763be56", + "location": "bid://dab64a3e-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5508, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$e804183b1e07cfa754330005de8ff5c864130a41", + "location": "bid://dac55a88-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics" + } + ], + "value": [ + { + "size": 5494, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$dad5640a5406c875b7fdaf4103b6edc2f763be56", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5508, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$e804183b1e07cfa754330005de8ff5c864130a41", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics" + } + ], + "files": [ + "dac55a88-50ea-11ea-b9c7-ac1f6b453620", + "dab64a3e-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac521c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.008Z", + "modified_date": "2020-02-04T15:29:59.158Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_counts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 32693698, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$a6f95a5e09c9e581321079f1f5fedd003ae5c221", + "location": "bid://dabc691e-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat" + }, + "value": { + "size": 32693698, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$a6f95a5e09c9e581321079f1f5fedd003ae5c221", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.gz", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat" + }, + "files": [ + "dabc691e-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dace5a0c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.935Z", + "modified_date": "2020-02-04T15:29:59.164Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "doc_basecounts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 13779990, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$f2677685cda917f388dd395b7715d07ae1090ff4", + "location": "bid://dac6da70-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md_FP_base_counts" + }, + { + "size": 13586169, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$a218a74b136aac74f9227e6cea7720c14fb0abce", + "location": "bid://dac8ab7a-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md_FP_base_counts" + } + ], + "value": [ + { + "size": 13779990, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$f2677685cda917f388dd395b7715d07ae1090ff4", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_K2902H_P001_d.rg.md_FP_base_counts" + }, + { + "size": 13586169, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$a218a74b136aac74f9227e6cea7720c14fb0abce", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md_FP_base_counts" + } + ], + "files": [ + "dac8ab7a-50ea-11ea-b9c7-ac1f6b453620", + "dac6da70-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dac380f0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.942Z", + "modified_date": "2020-02-04T15:29:59.171Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "gcbias_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6648, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$bb7469356a97449579bdd25e0ab600d2a8fa426d", + "location": "bid://daa80ba4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 6632, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$01cbb4e6bca86f1d857ccb6446b7188d6892d71a", + "location": "bid://dacc01e4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 6648, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$bb7469356a97449579bdd25e0ab600d2a8fa426d", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 6632, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$01cbb4e6bca86f1d857ccb6446b7188d6892d71a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "daa80ba4-50ea-11ea-b9c7-ac1f6b453620", + "dacc01e4-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab91930-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.946Z", + "modified_date": "2020-02-04T15:29:59.182Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "gcbias_summary", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 1201, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "checksum": "sha1$c6ca330351060e014b450e87b8fdd43731be79f6", + "location": "bid://daa012b4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 1199, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "checksum": "sha1$1932d9f758e45392212f1cf3c08a07ba988bde8c", + "location": "bid://dabc8eb2-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "value": [ + { + "size": 1201, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_P001_d.rg.md.gcbias.summary", + "checksum": "sha1$c6ca330351060e014b450e87b8fdd43731be79f6", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbias.summary", + "nameroot": "s_C_K2902H_P001_d.rg.md.gcbias" + }, + { + "size": 1199, + "class": "File", + "nameext": ".summary", + "basename": "s_C_K2902H_N001_d.rg.md.gcbias.summary", + "checksum": "sha1$1932d9f758e45392212f1cf3c08a07ba988bde8c", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbias.summary", + "nameroot": "s_C_K2902H_N001_d.rg.md.gcbias" + } + ], + "files": [ + "daa012b4-50ea-11ea-b9c7-ac1f6b453620", + "dabc8eb2-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa466d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.908Z", + "modified_date": "2020-02-04T15:29:59.188Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "insert_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 7754, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics", + "checksum": "sha1$db6602f7efaf6fcce248ac81838e52c3e252fd24", + "location": "bid://daa43358-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 7041, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics", + "checksum": "sha1$ea3bd53219598f06bbae0868dcf4ebbcc38a4a5e", + "location": "bid://dacaf2a4-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 7754, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_P001_d.rg.md.ismetrics", + "checksum": "sha1$db6602f7efaf6fcce248ac81838e52c3e252fd24", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.ismetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 7041, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_K2902H_N001_d.rg.md.ismetrics", + "checksum": "sha1$ea3bd53219598f06bbae0868dcf4ebbcc38a4a5e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.ismetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "dacaf2a4-50ea-11ea-b9c7-ac1f6b453620", + "daa43358-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa9e672-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.952Z", + "modified_date": "2020-02-04T15:29:59.195Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "conpair_pileups", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 55203868, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_P001_d.rg.md.pileup", + "checksum": "sha1$611ccefbf82e2cc1414acd833fcf7252483d1241", + "location": "bid://dab693e0-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 33915095, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_N001_d.rg.md.pileup", + "checksum": "sha1$3dacd4c14bd6a19468145e911e58e7a258199d4b", + "location": "bid://daaba0de-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 55203868, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_P001_d.rg.md.pileup", + "checksum": "sha1$611ccefbf82e2cc1414acd833fcf7252483d1241", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.pileup", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 33915095, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_K2902H_N001_d.rg.md.pileup", + "checksum": "sha1$3dacd4c14bd6a19468145e911e58e7a258199d4b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.pileup", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "dab693e0-50ea-11ea-b9c7-ac1f6b453620", + "daaba0de-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa35c1c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.982Z", + "modified_date": "2020-02-04T15:29:59.199Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "mutect_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 129554, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$a8f6c855b471bcf37a456ad441f72c8cf1b43be9", + "location": "bid://dab9f8aa-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 32515, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e4a5c3663691f31da1bba6352dc16e35f3a8a197", + "location": "bid://18c3cd81-baa9-4e25-8616-743956972e25", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "value": { + "size": 129554, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$a8f6c855b471bcf37a456ad441f72c8cf1b43be9", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 32515, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e4a5c3663691f31da1bba6352dc16e35f3a8a197", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "dab9f8aa-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dab865a8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.959Z", + "modified_date": "2020-02-04T15:29:59.203Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "mutect_callstats", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 172715192, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$7920889c2817038fb047c01d40187a083d928180", + "location": "bid://dabc1d38-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "value": { + "size": 172715192, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$7920889c2817038fb047c01d40187a083d928180", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.txt", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "dabc1d38-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa24804-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.975Z", + "modified_date": "2020-02-04T15:29:59.212Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "vardict_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 13247144, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$d377fe9dea989c10fc9bff2a02f215ac75aec897", + "location": "bid://daa5298e-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 429036, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e47841e84cd7b1c1ec384fa152d6ef4218b97704", + "location": "bid://9d092d5d-8b05-4a1b-bbc7-1238fb7b8eeb", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "value": { + "size": 13247144, + "class": "File", + "nameext": ".gz", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$d377fe9dea989c10fc9bff2a02f215ac75aec897", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 429036, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$e47841e84cd7b1c1ec384fa152d6ef4218b97704", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "daa5298e-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa4facc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.990Z", + "modified_date": "2020-02-04T15:29:59.216Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_txt_hisens", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 11388, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$e7474ae2f7a0479c54d379f089ac0b823ac06c2a", + "location": "bid://dabe2330-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf" + }, + "value": { + "size": 11388, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$e7474ae2f7a0479c54d379f089ac0b823ac06c2a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf" + }, + "files": [ + "dabe2330-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "daa4cc0a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.993Z", + "modified_date": "2020-02-04T15:29:59.220Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "facets_txt_purity", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 7525, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$0b46c330b744e3ef85d1f9c5ed585ee348cd6480", + "location": "bid://dacc5c48-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf" + }, + "value": { + "size": 7525, + "class": "File", + "nameext": ".txt", + "basename": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$0b46c330b744e3ef85d1f9c5ed585ee348cd6480", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.txt", + "nameroot": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf" + }, + "files": [ + "dacc5c48-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dabb434a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:17.925Z", + "modified_date": "2020-02-04T15:29:59.226Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "per_target_coverage", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 19302184, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "checksum": "sha1$b8a270c8a6c15845afd2f0b87c4f6d4318b0ded2", + "location": "bid://daa587c6-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 19114455, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "checksum": "sha1$63c8d87423a1c41b71e4347cf19ab6cb63285d94", + "location": "bid://dace0714-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "value": [ + { + "size": 19302184, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_P001_d.rg.md.hstmetrics", + "checksum": "sha1$b8a270c8a6c15845afd2f0b87c4f6d4318b0ded2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.hstmetrics", + "nameroot": "s_C_K2902H_P001_d.rg.md" + }, + { + "size": 19114455, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_K2902H_N001_d.rg.md.hstmetrics", + "checksum": "sha1$63c8d87423a1c41b71e4347cf19ab6cb63285d94", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.hstmetrics", + "nameroot": "s_C_K2902H_N001_d.rg.md" + } + ], + "files": [ + "daa587c6-50ea-11ea-b9c7-ac1f6b453620", + "dace0714-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "runner.port", + "pk": "dace320c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-11T22:53:18.011Z", + "modified_date": "2020-02-04T15:29:59.230Z", + "run": "daa13d24-50ea-11ea-b9c7-ac1f6b453620", + "name": "merged_file_unfiltered", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 2741838, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "checksum": "sha1$12f83bbc5e86c8dce79eeb145535f0c91e6ac6fb", + "location": "bid://dabad4d2-50ea-11ea-b9c7-ac1f6b453620", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs" + }, + "value": { + "size": 2741838, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "checksum": "sha1$12f83bbc5e86c8dce79eeb145535f0c91e6ac6fb", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.vcf", + "nameroot": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs" + }, + "files": [ + "dabad4d2-50ea-11ea-b9c7-ac1f6b453620" + ] + } + }, + { + "model": "file_system.file", + "pk": "dabdfd38-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:37:00.416Z", + "modified_date": "2019-12-09T23:37:00.416Z", + "file_name": "dbsnp_138.b37.excluding_sites_after_129.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.1581878020.vcf", + "file_type": 11, + "size": 2432705678, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab3905a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:40:05.224Z", + "modified_date": "2019-12-10T15:40:05.224Z", + "file_name": "Mills_and_1000G_gold_standard.indels.b37.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.1581878020.vcf", + "file_type": 11, + "size": 86369975, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa1a6d8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:41:25.361Z", + "modified_date": "2019-12-10T15:41:25.361Z", + "file_name": "1000G_phase1.snps.high_confidence.b37.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.1581878020.vcf", + "file_type": 11, + "size": 7313069069, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daad9ff6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:41:47.402Z", + "modified_date": "2019-12-10T15:41:47.402Z", + "file_name": "CosmicCodingMuts_v67_b37_20131024__NDS.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.1581878020.vcf", + "file_type": 11, + "size": 112402812, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab5fed0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:42:27.587Z", + "modified_date": "2019-12-10T15:42:27.587Z", + "file_name": "ExAC_nonTCGA.r0.3.1.sites.vep.vcf.1581878020.gz", + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.1581878020.gz", + "file_type": 11, + "size": 337197976, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac9d9c8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:15.075Z", + "modified_date": "2019-10-24T00:23:15.075Z", + "file_name": "refGene_b37.sorted.1581878020.txt", + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.1581878020.txt", + "file_type": 10, + "size": 9953757, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab111c2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:17.243Z", + "modified_date": "2019-10-24T00:23:17.243Z", + "file_name": "dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.1581878020.gz", + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.1581878020.gz", + "file_type": 11, + "size": 1015019014, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac595d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.167Z", + "modified_date": "2019-10-24T00:23:22.167Z", + "file_name": "FP_tiling_genotypes.1581878020.txt", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.1581878020.txt", + "file_type": 10, + "size": 38179, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa96544-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.408Z", + "modified_date": "2019-10-24T00:23:22.408Z", + "file_name": "FP_tiling_intervals.1581878020.intervals", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_intervals.1581878020.intervals", + "file_type": 7, + "size": 50804, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa7b032-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:16.737Z", + "modified_date": "2019-10-24T00:23:16.737Z", + "file_name": "human.hg19.excl.1581878020.tsv", + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.1581878020.tsv", + "file_type": 9, + "size": 6984, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daced162-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.884Z", + "modified_date": "2019-10-24T00:23:22.884Z", + "file_name": "IDT_Exome_v1_FP_b37_baits.1581878020.ilist", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_baits.1581878020.ilist", + "file_type": 7, + "size": 7083292, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab3b580-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:31:22.151Z", + "modified_date": "2019-12-09T23:31:22.151Z", + "file_name": "hotspot-list-union-v1-v2.1581878020.maf", + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.1581878020.maf", + "file_type": 24, + "size": 624846, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa0f882-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:23.578Z", + "modified_date": "2019-10-24T00:23:23.578Z", + "file_name": "IDT_Exome_v1_FP_b37_targets.1581878020.ilist", + "path": "/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/IDT_Exome_v1_FP_b37_targets.1581878020.ilist", + "file_type": 7, + "size": 6997415, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac975dc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.054Z", + "modified_date": "2019-10-24T00:24:03.054Z", + "file_name": "s_C_006284_N002_d.Group3.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006284_N002_d.Group3.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18001309333, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabb1d34-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.293Z", + "modified_date": "2019-10-24T00:24:03.293Z", + "file_name": "s_C_006537_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006537_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 13424642344, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab569fc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.625Z", + "modified_date": "2019-10-24T00:24:03.625Z", + "file_name": "s_C_006550_N002_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006550_N002_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 13851651891, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab96020-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.884Z", + "modified_date": "2019-10-24T00:24:03.884Z", + "file_name": "s_C_006609_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006609_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 16764556278, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dacb2198-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.123Z", + "modified_date": "2019-10-24T00:24:04.123Z", + "file_name": "s_C_006610_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006610_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17797687748, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa7ddaa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.371Z", + "modified_date": "2019-10-24T00:24:04.371Z", + "file_name": "s_C_006626_N001_d.Group19.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006626_N001_d.Group19.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 15450048427, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daad53d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.617Z", + "modified_date": "2019-10-24T00:24:04.617Z", + "file_name": "s_C_006627_N001_d.Group20.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006627_N001_d.Group20.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 21418934197, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac91556-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.857Z", + "modified_date": "2019-10-24T00:24:04.857Z", + "file_name": "s_C_006628_N001_d.Group15.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006628_N001_d.Group15.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 20242506560, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab98686-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.103Z", + "modified_date": "2019-10-24T00:24:05.103Z", + "file_name": "s_C_006630_N001_d.Group14.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006630_N001_d.Group14.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18554952981, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabdb3aa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.351Z", + "modified_date": "2019-10-24T00:24:05.351Z", + "file_name": "s_C_006631_N001_d.Group17.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006631_N001_d.Group17.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17671380235, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daad1f18-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.592Z", + "modified_date": "2019-10-24T00:24:05.592Z", + "file_name": "s_C_006632_N001_d.Group16.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006632_N001_d.Group16.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17956822592, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "da9de9b2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.836Z", + "modified_date": "2019-10-24T00:24:05.836Z", + "file_name": "s_C_006633_N001_d.Group13.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006633_N001_d.Group13.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 14995930592, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab1cb76-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.083Z", + "modified_date": "2019-10-24T00:24:06.083Z", + "file_name": "s_C_006635_N001_d.Group8.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006635_N001_d.Group8.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19452196435, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab5b524-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.409Z", + "modified_date": "2019-10-24T00:24:06.409Z", + "file_name": "s_C_006636_N001_d.Group9.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006636_N001_d.Group9.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19189450319, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab46df4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.658Z", + "modified_date": "2019-10-24T00:24:06.658Z", + "file_name": "s_C_006637_N002_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006637_N002_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 10888838079, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab31efe-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.901Z", + "modified_date": "2019-10-24T00:24:06.901Z", + "file_name": "s_C_006638_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006638_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 10088003650, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dacefc1e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.146Z", + "modified_date": "2019-10-24T00:24:07.146Z", + "file_name": "s_C_006639_N001_d.Group6.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006639_N001_d.Group6.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18437335538, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa1dc98-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.394Z", + "modified_date": "2019-10-24T00:24:07.394Z", + "file_name": "s_C_006640_N001_d.Group7.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006640_N001_d.Group7.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18781758639, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab3db5a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.716Z", + "modified_date": "2019-10-24T00:24:07.716Z", + "file_name": "s_C_006641_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006641_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 15954753147, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabb66b8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.979Z", + "modified_date": "2019-10-24T00:24:07.979Z", + "file_name": "s_C_006642_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006642_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17579506808, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa83930-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.240Z", + "modified_date": "2019-10-24T00:24:08.240Z", + "file_name": "s_C_006643_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006643_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17298827865, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabc433a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.520Z", + "modified_date": "2019-10-24T00:24:08.520Z", + "file_name": "s_C_006644_N001_d.Group3.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006644_N001_d.Group3.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19302206744, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "da9e6d7e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.779Z", + "modified_date": "2019-10-24T00:24:08.779Z", + "file_name": "s_C_006645_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006645_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 15523622669, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa5b7a0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.034Z", + "modified_date": "2019-10-24T00:24:09.034Z", + "file_name": "s_C_006646_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006646_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17007314582, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dab1f13c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.280Z", + "modified_date": "2019-10-24T00:24:09.281Z", + "file_name": "s_C_006647_N001_d.Group18.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006647_N001_d.Group18.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 20776680414, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac14e20-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.521Z", + "modified_date": "2019-10-24T00:24:09.521Z", + "file_name": "s_C_006648_N001_d.Group11.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006648_N001_d.Group11.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17232710261, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabcb4aa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.769Z", + "modified_date": "2019-10-24T00:24:09.769Z", + "file_name": "s_C_006649_N001_d.Group10.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006649_N001_d.Group10.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17366153538, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac8139a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.024Z", + "modified_date": "2019-10-24T00:24:10.024Z", + "file_name": "s_C_006650_N001_d.Group21.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006650_N001_d.Group21.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 16571180154, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa86414-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.268Z", + "modified_date": "2019-10-24T00:24:10.268Z", + "file_name": "s_C_006904_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006904_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18185638557, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa6730c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.512Z", + "modified_date": "2019-10-24T00:24:10.512Z", + "file_name": "s_C_006905_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006905_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18558003865, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "da9f2480-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.758Z", + "modified_date": "2019-10-24T00:24:10.758Z", + "file_name": "s_C_006906_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006906_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 16951748171, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa3ffdc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.995Z", + "modified_date": "2019-10-24T00:24:10.995Z", + "file_name": "s_C_006907_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006907_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 16389279357, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daa8e420-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.235Z", + "modified_date": "2019-10-24T00:24:11.235Z", + "file_name": "s_C_006996_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_006996_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 10690676737, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dac20b94-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.482Z", + "modified_date": "2019-10-24T00:24:11.482Z", + "file_name": "s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_0AEE89_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 13862649385, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dacf4ff2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.720Z", + "modified_date": "2019-10-24T00:24:11.720Z", + "file_name": "s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_1NPV4P_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 11105358516, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daac8620-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.963Z", + "modified_date": "2019-10-24T00:24:11.963Z", + "file_name": "s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_4W32NJ_N001_d.Group1.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 17582103301, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daaec3b8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.210Z", + "modified_date": "2019-10-24T00:24:12.210Z", + "file_name": "s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_H9KJFX_N001_d.Group2.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19349236927, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daac3936-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.513Z", + "modified_date": "2019-10-24T00:24:12.513Z", + "file_name": "s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_P5FLLT_N001_d.Group4.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 20668078544, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "da9f6166-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.759Z", + "modified_date": "2019-10-24T00:24:12.759Z", + "file_name": "s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_VC7LNE_N001_d.Group5.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 18873117772, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daaf0d5a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-06T20:06:03.478Z", + "modified_date": "2019-12-06T20:06:03.478Z", + "file_name": "s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/ci/resources/curated_bams/IDT_Exome_v1_FP_b37/s_C_WV53F0_N001_d.Group0.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 19501528278, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabd44b0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-06T20:05:01.506Z", + "modified_date": "2019-12-06T20:05:01.506Z", + "file_name": "b37.1581878020.fasta", + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.1581878020.fasta", + "file_type": 2, + "size": 3189750467, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "daaf32ee-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:19.218Z", + "modified_date": "2019-10-24T00:23:19.218Z", + "file_name": "GRCm38.1581878020.fasta", + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.1581878020.fasta", + "file_type": 2, + "size": 2769885087, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabd69fe-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:34:12.885Z", + "modified_date": "2019-12-09T23:34:12.886Z", + "file_name": "hapmap_3.3.b37.1581878020.vcf", + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.1581878020.vcf", + "file_type": 11, + "size": 225898391, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dabbf808-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-11-29T21:15:53.295Z", + "modified_date": "2020-02-03T22:05:10.092Z", + "file_name": "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.1581878020.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.1581878020.gz", + "file_type": 1, + "size": 5966546453, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "daad7a4e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-11-29T21:15:53.254Z", + "modified_date": "2020-02-03T22:05:10.069Z", + "file_name": "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.1581878020.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.1581878020.gz", + "file_type": 1, + "size": 5832468368, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "dacc897a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-11-29T21:15:51.010Z", + "modified_date": "2020-02-03T22:05:10.138Z", + "file_name": "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.1581878020.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.1581878020.gz", + "file_type": 1, + "size": 3576965127, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.file", + "pk": "dab2170c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-11-29T21:15:50.983Z", + "modified_date": "2020-02-03T22:05:10.112Z", + "file_name": "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.1581878020.gz", + "path": "/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.1581878020.gz", + "file_type": 1, + "size": 3592299152, + "file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a" + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac4e968-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:37:00.429Z", + "modified_date": "2019-12-09T23:37:00.429Z", + "file": "dabdfd38-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daacfb6e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:40:05.251Z", + "modified_date": "2019-12-10T15:40:05.251Z", + "file": "dab3905a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacd8974-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:41:25.375Z", + "modified_date": "2019-12-10T15:41:25.375Z", + "file": "daa1a6d8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa0c0ba-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:41:47.412Z", + "modified_date": "2019-12-10T15:41:47.412Z", + "file": "daad9ff6-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa212c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-10T15:42:27.601Z", + "modified_date": "2019-12-10T15:42:27.601Z", + "file": "dab5fed0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa55936-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:15.094Z", + "modified_date": "2019-10-24T00:23:15.094Z", + "file": "dac9d9c8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "refseq" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac0d3a0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:17.253Z", + "modified_date": "2019-10-24T00:23:17.253Z", + "file": "dab111c2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "facets_snps" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac7b15c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.177Z", + "modified_date": "2019-10-24T00:23:22.177Z", + "file": "dac595d4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "FP_genotypes" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab1a6be-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.418Z", + "modified_date": "2019-10-24T00:23:22.418Z", + "file": "daa96544-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "FP_intervals" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacbd61a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:16.747Z", + "modified_date": "2019-10-24T00:23:16.747Z", + "file": "daa7b032-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "delly" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab8898e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:22.894Z", + "modified_date": "2019-10-24T00:23:22.894Z", + "file": "daced162-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "baits_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab15aa6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:31:22.187Z", + "modified_date": "2019-12-09T23:31:22.187Z", + "file": "dab3b580-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daae7bd8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:23.589Z", + "modified_date": "2019-10-24T00:23:23.589Z", + "file": "daa0f882-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "targets_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daafa184-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.064Z", + "modified_date": "2019-10-24T00:24:03.064Z", + "file": "dac975dc-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab76a5e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.303Z", + "modified_date": "2019-10-24T00:24:03.303Z", + "file": "dabb1d34-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaa5ec2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.636Z", + "modified_date": "2019-10-24T00:24:03.636Z", + "file": "dab569fc-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daab28de-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:03.895Z", + "modified_date": "2019-10-24T00:24:03.895Z", + "file": "dab96020-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac18da4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.133Z", + "modified_date": "2019-10-24T00:24:04.133Z", + "file": "dacb2198-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaad870-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.381Z", + "modified_date": "2019-10-24T00:24:04.381Z", + "file": "daa7ddaa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa27cd4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.627Z", + "modified_date": "2019-10-24T00:24:04.627Z", + "file": "daad53d4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabd2156-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:04.868Z", + "modified_date": "2019-10-24T00:24:04.868Z", + "file": "dac91556-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacdb340-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.113Z", + "modified_date": "2019-10-24T00:24:05.113Z", + "file": "dab98686-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab81dd2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.361Z", + "modified_date": "2019-10-24T00:24:05.361Z", + "file": "dabdb3aa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab49310-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.600Z", + "modified_date": "2019-10-24T00:24:05.601Z", + "file": "daad1f18-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaf5896-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:05.847Z", + "modified_date": "2019-10-24T00:24:05.847Z", + "file": "da9de9b2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaa0e36-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.093Z", + "modified_date": "2019-10-24T00:24:06.093Z", + "file": "dab1cb76-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daca0aec-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.419Z", + "modified_date": "2019-10-24T00:24:06.419Z", + "file": "dab5b524-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab26a22-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.667Z", + "modified_date": "2019-10-24T00:24:06.667Z", + "file": "dab46df4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabe6d54-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:06.911Z", + "modified_date": "2019-10-24T00:24:06.911Z", + "file": "dab31efe-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab78e4e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.160Z", + "modified_date": "2019-10-24T00:24:07.160Z", + "file": "dacefc1e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab74650-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.404Z", + "modified_date": "2019-10-24T00:24:07.404Z", + "file": "daa1dc98-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacddcf8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.725Z", + "modified_date": "2019-10-24T00:24:07.725Z", + "file": "dab3db5a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacd3596-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:07.989Z", + "modified_date": "2019-10-24T00:24:07.989Z", + "file": "dabb66b8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab6d148-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.249Z", + "modified_date": "2019-10-24T00:24:08.249Z", + "file": "daa83930-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacd5f58-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.532Z", + "modified_date": "2019-10-24T00:24:08.532Z", + "file": "dabc433a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaea022-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:08.789Z", + "modified_date": "2019-10-24T00:24:08.789Z", + "file": "da9e6d7e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daaf7d3a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.045Z", + "modified_date": "2019-10-24T00:24:09.046Z", + "file": "daa5b7a0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabb8c10-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.290Z", + "modified_date": "2019-10-24T00:24:09.290Z", + "file": "dab1f13c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daccdf74-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.530Z", + "modified_date": "2019-10-24T00:24:09.530Z", + "file": "dac14e20-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab7b27a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:09.779Z", + "modified_date": "2019-10-24T00:24:09.779Z", + "file": "dabcb4aa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9d658c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.035Z", + "modified_date": "2019-10-24T00:24:10.035Z", + "file": "dac8139a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabbd440-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.278Z", + "modified_date": "2019-10-24T00:24:10.278Z", + "file": "daa86414-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daadc544-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.522Z", + "modified_date": "2019-10-24T00:24:10.522Z", + "file": "daa6730c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa4992e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:10.768Z", + "modified_date": "2019-10-24T00:24:10.768Z", + "file": "da9f2480-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa39b00-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.005Z", + "modified_date": "2019-10-24T00:24:11.005Z", + "file": "daa3ffdc-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa78404-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.244Z", + "modified_date": "2019-10-24T00:24:11.244Z", + "file": "daa8e420-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabf7834-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.492Z", + "modified_date": "2019-10-24T00:24:11.492Z", + "file": "dac20b94-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daade97a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.730Z", + "modified_date": "2019-10-24T00:24:11.731Z", + "file": "dacf4ff2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac47910-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:11.974Z", + "modified_date": "2019-10-24T00:24:11.974Z", + "file": "daac8620-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac71242-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.219Z", + "modified_date": "2019-10-24T00:24:12.219Z", + "file": "daaec3b8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab7d642-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.525Z", + "modified_date": "2019-10-24T00:24:12.525Z", + "file": "daac3936-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabeb4bc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:24:12.769Z", + "modified_date": "2019-10-24T00:24:12.769Z", + "file": "da9f6166-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dace82de-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-06T20:06:03.487Z", + "modified_date": "2019-12-06T20:06:03.487Z", + "file": "daaf0d5a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "assay": "IDT_Exome_v1_FP_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac09610-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-06T20:05:01.781Z", + "modified_date": "2019-12-06T20:05:01.781Z", + "file": "dabd44b0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab4b67e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-10-24T00:23:19.228Z", + "modified_date": "2019-10-24T00:23:19.228Z", + "file": "daaf32ee-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": { + "genome": "GRCh38", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9f9db6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-09T23:34:12.902Z", + "modified_date": "2019-12-09T23:34:12.902Z", + "file": "dabd69fe-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa2b244-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2020-02-03T22:05:10.089Z", + "modified_date": "2020-02-03T22:05:10.089Z", + "file": "dabbf808-50ea-11ea-b9c7-ac1f6b453620", + "version": 2, + "metadata": { + "R": "R1", + "sex": "M", + "runId": "PITT_0390_1581878020", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-15", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_1_1581878020", + "barcodeId": "IDT366", + "libraryId": null, + "patientId": "C-K2902H_1581878020", + "requestId": "09670_D_1581878020", + "flowCellId": "H7HCTBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-P001-d_1581878020", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Primary", + "barcodeIndex": "ACATACGG", + "labHeadEmail": "user@internet.com", + "oncoTreeCode": "DDLS", + "preservation": "Frozen", + "sampleOrigin": "Tissue", + "specimenType": "Biopsy", + "flowCellLanes": [ + 1, + 2, + 3, + 4, + 5, + 6 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "S16-68609_1581878020", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "S16-68609_1581878020", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 40.03237153464453 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9fda88-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2020-02-03T22:05:10.065Z", + "modified_date": "2020-02-03T22:05:10.065Z", + "file": "daad7a4e-50ea-11ea-b9c7-ac1f6b453620", + "version": 2, + "metadata": { + "R": "R2", + "sex": "M", + "runId": "PITT_0390_1581878020", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-15", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_1_1581878020", + "barcodeId": "IDT366", + "libraryId": "09670_D_1_1_1_1_1", + "patientId": "C-K2902H_1581878020", + "requestId": "09670_D_1581878020", + "flowCellId": "H7HCTBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-P001-d_1581878020", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Primary", + "barcodeIndex": "ACATACGG", + "labHeadEmail": "user@internet.com", + "oncoTreeCode": "DDLS", + "preservation": "Frozen", + "sampleOrigin": "Tissue", + "specimenType": "Biopsy", + "flowCellLanes": [ + 1, + 2, + 3, + 4, + 5, + 6 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "S16-68609_1581878020", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "S16-68609_1581878020", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 40.03237153464453 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab28ed0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2020-02-03T22:05:10.135Z", + "modified_date": "2020-02-03T22:05:10.136Z", + "file": "dacc897a-50ea-11ea-b9c7-ac1f6b453620", + "version": 2, + "metadata": { + "R": "R1", + "sex": "M", + "runId": "PITT_0391_1581878020", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-19", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_46_1581878020", + "barcodeId": null, + "libraryId": null, + "patientId": "C-K2902H_1581878020", + "requestId": "09670_D_1581878020", + "flowCellId": "H7FKJBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-N001-d_1581878020", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Normal", + "barcodeIndex": null, + "labHeadEmail": "user@internet.com", + "oncoTreeCode": null, + "preservation": "EDTA-Streck", + "sampleOrigin": "Whole Blood", + "specimenType": "Blood", + "flowCellLanes": [ + 5, + 6, + 7, + 8 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "P-0017035-N01-WES_1581878020", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "P-0017035-N01-WES_1581878020", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 32.135796910139796 + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac3bf0c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2020-02-03T22:05:10.109Z", + "modified_date": "2020-02-03T22:05:10.109Z", + "file": "dab2170c-50ea-11ea-b9c7-ac1f6b453620", + "version": 2, + "metadata": { + "R": "R2", + "sex": "M", + "runId": "PITT_0391_1581878020", + "recipe": "WholeExomeSequencing", + "baitSet": "IDT_Exome_v1_FP_BAITS", + "piEmail": "", + "runDate": "2019-08-19", + "runMode": "HiSeq High Output", + "species": "Human", + "sampleId": "09670_D_46_1581878020", + "barcodeId": null, + "libraryId": "09670_D_46_1", + "patientId": "C-K2902H_1581878020", + "requestId": "09670_D_1581878020", + "flowCellId": "H7FKJBBXY", + "readLength": "101/8/101", + "sampleName": "C-K2902H-N001-d_1581878020", + "captureName": null, + "igocomplete": true, + "labHeadName": "John Smith", + "sampleClass": "Normal", + "barcodeIndex": null, + "labHeadEmail": "user@internet.com", + "oncoTreeCode": null, + "preservation": "EDTA-Streck", + "sampleOrigin": "Whole Blood", + "specimenType": "Blood", + "flowCellLanes": [ + 5, + 6, + 7, + 8 + ], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "P-0017035-N01-WES_1581878020", + "investigatorName": "Bob Sagat", + "investigatorEmail": "user2@internet.com", + "projectManagerName": "Franklin, Rosalind", + "investigatorSampleId": "P-0017035-N01-WES_1581878020", + "captureConcentrationNm": null, + "libraryConcentrationNgul": 32.135796910139796 + }, + "user": null + } + }, + { + "model": "file_system.file", + "pk": "dab424ca-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.368Z", + "modified_date": "2019-12-14T12:08:14.368Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.annotate-variants.1581878020.vcf", + "file_type": 11, + "size": 65612975, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacd0954-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.539Z", + "modified_date": "2019-12-14T12:08:13.539Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.1581878020.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.muts.1581878020.maf", + "file_type": 24, + "size": 181310718, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daba66aa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.575Z", + "modified_date": "2019-12-14T12:08:13.575Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 22899967017, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab07dc0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.614Z", + "modified_date": "2019-12-14T12:08:13.614Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.1581878020.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.1581878020.bam", + "file_type": 3, + "size": 14961505727, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa90ff4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.658Z", + "modified_date": "2019-12-14T12:08:13.658Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk000_cl.1581878020.stats", + "file_type": 21, + "size": 2641, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac27a66-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.676Z", + "modified_date": "2019-12-14T12:08:13.676Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk001_cl.1581878020.stats", + "file_type": 21, + "size": 2611, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab05854-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.695Z", + "modified_date": "2019-12-14T12:08:13.695Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R1-001.chunk002_cl.1581878020.stats", + "file_type": 21, + "size": 2576, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daab79ba-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.713Z", + "modified_date": "2019-12-14T12:08:13.713Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk000_cl.1581878020.stats", + "file_type": 21, + "size": 2764, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa9905a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.731Z", + "modified_date": "2019-12-14T12:08:13.731Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R1-001.chunk001_cl.1581878020.stats", + "file_type": 21, + "size": 2714, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabaafca-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.754Z", + "modified_date": "2019-12-14T12:08:13.754Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk000_cl.1581878020.stats", + "file_type": 21, + "size": 2818, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab3444c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.778Z", + "modified_date": "2019-12-14T12:08:13.778Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk001_cl.1581878020.stats", + "file_type": 21, + "size": 2815, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacfcb44-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.803Z", + "modified_date": "2019-12-14T12:08:13.803Z", + "file_name": "H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7HCTBBXY_ACATACGG-IGO-09670-D-1-S11-R2-001.chunk002_cl.1581878020.stats", + "file_type": 21, + "size": 2775, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacba802-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.820Z", + "modified_date": "2019-12-14T12:08:13.820Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk000_cl.1581878020.stats", + "file_type": 21, + "size": 2873, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabed8d4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.836Z", + "modified_date": "2019-12-14T12:08:13.836Z", + "file_name": "H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.1581878020.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/H7FKJBBXY-IGO-09670-D-46-S12-R2-001.chunk001_cl.1581878020.stats", + "file_type": 21, + "size": 2826, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab17ef0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.858Z", + "modified_date": "2019-12-14T12:08:13.858Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.1581878020.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.1581878020.maf", + "file_type": 24, + "size": 59073, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "da9eab36-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.880Z", + "modified_date": "2019-12-14T12:08:13.880Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.1581878020.pdf", + "file_type": 21, + "size": 8189, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab62496-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.896Z", + "modified_date": "2019-12-14T12:08:13.896Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.1581878020.pdf", + "file_type": 21, + "size": 8219, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac1cad0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.930Z", + "modified_date": "2019-12-14T12:08:13.930Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.asmetrics", + "file_type": 21, + "size": 2171, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab8f3f6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.947Z", + "modified_date": "2019-12-14T12:08:13.947Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.asmetrics", + "file_type": 21, + "size": 2134, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daacadd0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.969Z", + "modified_date": "2019-12-14T12:08:13.969Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.out", + "file_type": 21, + "size": 603, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daaa358c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.986Z", + "modified_date": "2019-12-14T12:08:13.986Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.out", + "file_type": 21, + "size": 602, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daae0d88-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.009Z", + "modified_date": "2019-12-14T12:08:14.009Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.1581878020.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.CNCF.1581878020.png", + "file_type": 21, + "size": 124853, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daaaaf62-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.027Z", + "modified_date": "2019-12-14T12:08:14.027Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.1581878020.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.CNCF.1581878020.png", + "file_type": 21, + "size": 111084, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac746b8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.050Z", + "modified_date": "2019-12-14T12:08:14.050Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.seg", + "file_type": 21, + "size": 4777, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daaa865e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.068Z", + "modified_date": "2019-12-14T12:08:14.068Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.seg", + "file_type": 21, + "size": 3222, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac63ac0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.092Z", + "modified_date": "2019-12-14T12:08:14.092Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbias.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbias.1581878020.pdf", + "file_type": 21, + "size": 6784, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa6f9b2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.108Z", + "modified_date": "2019-12-14T12:08:14.108Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbias.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbias.1581878020.pdf", + "file_type": 21, + "size": 6794, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa754ac-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.131Z", + "modified_date": "2019-12-14T12:08:14.131Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.hsmetrics", + "file_type": 21, + "size": 5016, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab9ac60-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.147Z", + "modified_date": "2019-12-14T12:08:14.147Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.hsmetrics", + "file_type": 21, + "size": 5029, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac340f4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.168Z", + "modified_date": "2019-12-14T12:08:14.168Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.ismetrics.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.ismetrics.1581878020.pdf", + "file_type": 21, + "size": 13994, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacf7a18-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.183Z", + "modified_date": "2019-12-14T12:08:14.183Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.ismetrics.1581878020.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.ismetrics.1581878020.pdf", + "file_type": 21, + "size": 12712, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab36a62-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.203Z", + "modified_date": "2019-12-14T12:08:14.203Z", + "file_name": "s_C_K2902H_P001_d.rg.1581878020.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.1581878020.md_metrics", + "file_type": 21, + "size": 2900, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daafe950-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.219Z", + "modified_date": "2019-12-14T12:08:14.219Z", + "file_name": "s_C_K2902H_N001_d.rg.1581878020.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.1581878020.md_metrics", + "file_type": 21, + "size": 2866, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac43b26-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.242Z", + "modified_date": "2019-12-14T12:08:14.242Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.1581878020.vcf", + "file_type": 11, + "size": 24213327, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac9a854-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.263Z", + "modified_date": "2019-12-14T12:08:14.263Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.1581878020.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.combined-variants.vcf.1581878020.gz", + "file_type": 21, + "size": 13440159, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab00e76-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.302Z", + "modified_date": "2019-12-14T12:08:14.302Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.1581878020.vcf", + "file_type": 11, + "size": 19739, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac8e07c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.324Z", + "modified_date": "2019-12-14T12:08:14.324Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.pass.vep.portal.1581878020.txt", + "file_type": 10, + "size": 5795, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab0c884-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.346Z", + "modified_date": "2019-12-14T12:08:14.346Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.1581878020.vcf", + "file_type": 11, + "size": 403491742, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa9bb7a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.390Z", + "modified_date": "2019-12-14T12:08:14.390Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.1581878020.Rdata", + "file_type": 21, + "size": 8622126, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab9d2c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.406Z", + "modified_date": "2019-12-14T12:08:14.406Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.1581878020.Rdata", + "file_type": 21, + "size": 8618530, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab64a3e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.428Z", + "modified_date": "2019-12-14T12:08:14.428Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.1581878020.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.qmetrics.1581878020.quality_by_cycle_metrics", + "file_type": 21, + "size": 5494, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac55a88-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.445Z", + "modified_date": "2019-12-14T12:08:14.445Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.1581878020.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads.qmetrics.1581878020.quality_by_cycle_metrics", + "file_type": 21, + "size": 5508, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabc691e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.466Z", + "modified_date": "2019-12-14T12:08:14.466Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.1581878020.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads.dat.1581878020.gz", + "file_type": 21, + "size": 32693698, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac6da70-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.488Z", + "modified_date": "2019-12-14T12:08:14.488Z", + "file_name": "s_C_K2902H_P001_d.rg.md_FP_base_counts.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md_FP_base_counts.1581878020.txt", + "file_type": 10, + "size": 13779990, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dac8ab7a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.504Z", + "modified_date": "2019-12-14T12:08:14.504Z", + "file_name": "s_C_K2902H_N001_d.rg.md_FP_base_counts.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md_FP_base_counts.1581878020.txt", + "file_type": 10, + "size": 13586169, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa80ba4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.527Z", + "modified_date": "2019-12-14T12:08:14.527Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.gcbiasmetrics", + "file_type": 21, + "size": 6648, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacc01e4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.544Z", + "modified_date": "2019-12-14T12:08:14.544Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.gcbiasmetrics", + "file_type": 21, + "size": 6632, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa012b4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.574Z", + "modified_date": "2019-12-14T12:08:14.575Z", + "file_name": "s_C_K2902H_P001_d.rg.md.gcbias.1581878020.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.gcbias.1581878020.summary", + "file_type": 21, + "size": 1201, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabc8eb2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.593Z", + "modified_date": "2019-12-14T12:08:14.593Z", + "file_name": "s_C_K2902H_N001_d.rg.md.gcbias.1581878020.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.gcbias.1581878020.summary", + "file_type": 21, + "size": 1199, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa43358-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.616Z", + "modified_date": "2019-12-14T12:08:14.616Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.ismetrics", + "file_type": 21, + "size": 7754, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacaf2a4-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.635Z", + "modified_date": "2019-12-14T12:08:14.635Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.ismetrics", + "file_type": 21, + "size": 7041, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab693e0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.658Z", + "modified_date": "2019-12-14T12:08:14.658Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.pileup", + "file_type": 21, + "size": 55203868, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daaba0de-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.675Z", + "modified_date": "2019-12-14T12:08:14.675Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.pileup", + "file_type": 21, + "size": 33915095, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dab9f8aa-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.697Z", + "modified_date": "2019-12-14T12:08:14.697Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.1581878020.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.1581878020.gz", + "file_type": 21, + "size": 129554, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabc1d38-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.738Z", + "modified_date": "2019-12-14T12:08:14.738Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.mutect.1581878020.txt", + "file_type": 10, + "size": 172715192, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa5298e-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.762Z", + "modified_date": "2019-12-14T12:08:14.762Z", + "file_name": "s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.1581878020.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.abra.printreads.s_C_K2902H_N001_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.1581878020.gz", + "file_type": 21, + "size": 13247144, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabe2330-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.800Z", + "modified_date": "2019-12-14T12:08:14.800Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_hisens.cncf.1581878020.txt", + "file_type": 10, + "size": 11388, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dacc5c48-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.822Z", + "modified_date": "2019-12-14T12:08:14.822Z", + "file_name": "s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.1581878020.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.abra.printreads__s_C_K2902H_P001_d.rg.md.abra.printreads_purity.cncf.1581878020.txt", + "file_type": 10, + "size": 7525, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "daa587c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.844Z", + "modified_date": "2019-12-14T12:08:14.844Z", + "file_name": "s_C_K2902H_P001_d.rg.md.1581878020.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.rg.md.1581878020.hstmetrics", + "file_type": 21, + "size": 19302184, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dace0714-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.860Z", + "modified_date": "2019-12-14T12:08:14.860Z", + "file_name": "s_C_K2902H_N001_d.rg.md.1581878020.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_N001_d.rg.md.1581878020.hstmetrics", + "file_type": 21, + "size": 19114455, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "dabad4d2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.883Z", + "modified_date": "2019-12-14T12:08:14.883Z", + "file_name": "s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.1581878020.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_sv/daa13d24-50ea-11ea-b9c7-ac1f6b453620/outputs/s_C_K2902H_P001_d.s_C_K2902H_N001_d.svs.1581878020.vcf", + "file_type": 11, + "size": 2741838, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.filemetadata", + "pk": "daac5fe2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.373Z", + "modified_date": "2019-12-14T12:08:14.373Z", + "file": "dab424ca-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabd8fce-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.552Z", + "modified_date": "2019-12-14T12:08:13.552Z", + "file": "dacd0954-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab0343c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.580Z", + "modified_date": "2019-12-14T12:08:13.580Z", + "file": "daba66aa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daabc7d0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.619Z", + "modified_date": "2019-12-14T12:08:13.619Z", + "file": "dab07dc0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa8ba86-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.663Z", + "modified_date": "2019-12-14T12:08:13.663Z", + "file": "daa90ff4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa5e824-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.681Z", + "modified_date": "2019-12-14T12:08:13.681Z", + "file": "dac27a66-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa2e70a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.700Z", + "modified_date": "2019-12-14T12:08:13.700Z", + "file": "dab05854-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac304c2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.718Z", + "modified_date": "2019-12-14T12:08:13.718Z", + "file": "daab79ba-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab44a4a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.736Z", + "modified_date": "2019-12-14T12:08:13.736Z", + "file": "daa9905a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabe4950-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.759Z", + "modified_date": "2019-12-14T12:08:13.759Z", + "file": "dabaafca-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab6fe66-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.785Z", + "modified_date": "2019-12-14T12:08:13.785Z", + "file": "dab3444c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daba1eac-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.807Z", + "modified_date": "2019-12-14T12:08:13.807Z", + "file": "dacfcb44-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac2c6e2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.824Z", + "modified_date": "2019-12-14T12:08:13.824Z", + "file": "dacba802-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daacd576-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.841Z", + "modified_date": "2019-12-14T12:08:13.841Z", + "file": "dabed8d4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab0a3fe-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.863Z", + "modified_date": "2019-12-14T12:08:13.863Z", + "file": "dab17ef0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daba8c5c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.884Z", + "modified_date": "2019-12-14T12:08:13.884Z", + "file": "da9eab36-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab66fd2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.900Z", + "modified_date": "2019-12-14T12:08:13.900Z", + "file": "dab62496-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa6a106-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.935Z", + "modified_date": "2019-12-14T12:08:13.935Z", + "file": "dac1cad0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabbb05a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.952Z", + "modified_date": "2019-12-14T12:08:13.952Z", + "file": "dab8f3f6-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa89088-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.973Z", + "modified_date": "2019-12-14T12:08:13.973Z", + "file": "daacadd0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9da8a8-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:13.991Z", + "modified_date": "2019-12-14T12:08:13.991Z", + "file": "daaa358c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa04d4c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.014Z", + "modified_date": "2019-12-14T12:08:14.014Z", + "file": "daae0d88-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab4fe2c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.031Z", + "modified_date": "2019-12-14T12:08:14.032Z", + "file": "daaaaf62-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daab005c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.055Z", + "modified_date": "2019-12-14T12:08:14.055Z", + "file": "dac746b8-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac6a672-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.074Z", + "modified_date": "2019-12-14T12:08:14.074Z", + "file": "daaa865e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab136de-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.097Z", + "modified_date": "2019-12-14T12:08:14.097Z", + "file": "dac63ac0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab24588-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.113Z", + "modified_date": "2019-12-14T12:08:14.113Z", + "file": "daa6f9b2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9ee8c6-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.135Z", + "modified_date": "2019-12-14T12:08:14.135Z", + "file": "daa754ac-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab2b338-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.152Z", + "modified_date": "2019-12-14T12:08:14.152Z", + "file": "dab9ac60-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa32972-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.172Z", + "modified_date": "2019-12-14T12:08:14.172Z", + "file": "dac340f4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daae584c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.187Z", + "modified_date": "2019-12-14T12:08:14.187Z", + "file": "dacf7a18-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa616d2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.208Z", + "modified_date": "2019-12-14T12:08:14.208Z", + "file": "dab36a62-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabcfdc0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.223Z", + "modified_date": "2019-12-14T12:08:14.223Z", + "file": "daafe950-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac4b132-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.246Z", + "modified_date": "2019-12-14T12:08:14.246Z", + "file": "dac43b26-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daabee4a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.268Z", + "modified_date": "2019-12-14T12:08:14.268Z", + "file": "dac9a854-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabe9108-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.307Z", + "modified_date": "2019-12-14T12:08:14.307Z", + "file": "dab00e76-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa088c0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.329Z", + "modified_date": "2019-12-14T12:08:14.329Z", + "file": "dac8e07c-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab5906c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.351Z", + "modified_date": "2019-12-14T12:08:14.351Z", + "file": "dab0c884-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daca3a3a-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.394Z", + "modified_date": "2019-12-14T12:08:14.394Z", + "file": "daa9bb7a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daca6992-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.411Z", + "modified_date": "2019-12-14T12:08:14.411Z", + "file": "dab9d2c6-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac052c2-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.432Z", + "modified_date": "2019-12-14T12:08:14.432Z", + "file": "dab64a3e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daac1398-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.449Z", + "modified_date": "2019-12-14T12:08:14.449Z", + "file": "dac55a88-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa93aec-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.470Z", + "modified_date": "2019-12-14T12:08:14.470Z", + "file": "dabc691e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac3fcec-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.492Z", + "modified_date": "2019-12-14T12:08:14.492Z", + "file": "dac6da70-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacc3114-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.509Z", + "modified_date": "2019-12-14T12:08:14.509Z", + "file": "dac8ab7a-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacf27ac-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.532Z", + "modified_date": "2019-12-14T12:08:14.532Z", + "file": "daa80ba4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab52226-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.548Z", + "modified_date": "2019-12-14T12:08:14.548Z", + "file": "dacc01e4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daae3434-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.580Z", + "modified_date": "2019-12-14T12:08:14.580Z", + "file": "daa012b4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa72784-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.598Z", + "modified_date": "2019-12-14T12:08:14.598Z", + "file": "dabc8eb2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacac6bc-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.621Z", + "modified_date": "2019-12-14T12:08:14.621Z", + "file": "daa43358-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "daa64530-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.640Z", + "modified_date": "2019-12-14T12:08:14.640Z", + "file": "dacaf2a4-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "da9d0dd0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.663Z", + "modified_date": "2019-12-14T12:08:14.663Z", + "file": "dab693e0-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabcda48-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.679Z", + "modified_date": "2019-12-14T12:08:14.679Z", + "file": "daaba0de-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab84190-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.702Z", + "modified_date": "2019-12-14T12:08:14.702Z", + "file": "dab9f8aa-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dabfba56-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.743Z", + "modified_date": "2019-12-14T12:08:14.743Z", + "file": "dabc1d38-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dab40148-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.766Z", + "modified_date": "2019-12-14T12:08:14.766Z", + "file": "daa5298e-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacb5046-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.805Z", + "modified_date": "2019-12-14T12:08:14.805Z", + "file": "dabe2330-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac6067c-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.827Z", + "modified_date": "2019-12-14T12:08:14.827Z", + "file": "dacc5c48-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dacb7c06-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.848Z", + "modified_date": "2019-12-14T12:08:14.848Z", + "file": "daa587c6-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac77fca-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.865Z", + "modified_date": "2019-12-14T12:08:14.865Z", + "file": "dace0714-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "dac00dd0-50ea-11ea-b9c7-ac1f6b453620", + "fields": { + "created_date": "2019-12-14T12:08:14.887Z", + "modified_date": "2019-12-14T12:08:14.887Z", + "file": "dabad4d2-50ea-11ea-b9c7-ac1f6b453620", + "version": 0, + "metadata": {}, + "user": null + } + } +] diff --git a/runner/operator/roslin_qc_operator/bin/input.py b/runner/operator/roslin_qc_operator/bin/input.py index 06f61d10c..2638c054d 100644 --- a/runner/operator/roslin_qc_operator/bin/input.py +++ b/runner/operator/roslin_qc_operator/bin/input.py @@ -13,7 +13,7 @@ scripts_bin: runparams['value']['scripts_bin'] assay: ---MISSING--- pi: ---MISSING--- - pi-email: ---MISSING--- + pi_email: ---MISSING--- ref_fasta: ref_fasta clstats1: [clstats1] clstats2: [clstats2] @@ -28,9 +28,9 @@ """ import json import urllib -from file_system.models import FileMetadata +from file_system.models import FileMetadata, File from runner.models import Port -from pprint import pprint +import urllib.parse def build_sample(filemetadata_instance, company_name = "MSKCC", platform = "Illumina"): """ @@ -136,6 +136,25 @@ def parse_pairs_from_ports(ports_queryset): pairs.append(pair_set) return(pairs) +def parse_bams_from_ports(ports_queryset): + """ + Search a set of Ports for the 'bams' entries and format them into a list of tumor normal pair entries + """ + bam_ports = ports_queryset.filter(name = "bams") + bams = [] + for bam in bam_ports: + # get the Beagle database id for each bam file out of the `db_value` field` + # TODO: need to refactor this to get it from the Port.files association; right now that association lacks the tumor/normal information needed to know which bam is which + files_data = bam.db_value + tumor_bam_data = files_data[0] + tumor_bam_bid = urllib.parse.urlsplit(tumor_bam_data['location']).netloc + tumor_bam_file_instance = File.objects.get(id = tumor_bam_bid) + normal_bam_data = files_data[1] + normal_bam_bid = urllib.parse.urlsplit(normal_bam_data['location']).netloc + normal_bam_file_instance = File.objects.get(id = normal_bam_bid) + bams.append([tumor_bam_file_instance, normal_bam_file_instance]) + return(bams) + def pair_to_cwl(pair): """ Convert a single tumor normal pair dict to CWL format datastructure @@ -168,6 +187,21 @@ def pair_to_cwl(pair): output = (tumor, normal) return(output) +def bams_to_cwl(bams): + """ + Convert the items in the bams list to CWL format + + bams = [ [File.objects.get(file_name = 's_C_K2902H_P001_d.rg.md.abra.printreads.bam'), File.objects.get(file_name = 's_C_K2902H_N001_d.rg.md.abra.printreads.bam')], ... ] + """ + bam_cwls = [] + for item in bams: + tumor_bam = item[0] + normal_bam = item[1] + tumor_bam_cwl = file_to_cwl(tumor_bam) + normal_bam_cwl = file_to_cwl(normal_bam) + bam_cwls.append([tumor_bam_cwl, normal_bam_cwl]) + return(bam_cwls) + def parse_runparams_from_ports(ports_queryset): """ Get the runparams from a Port queryset @@ -175,13 +209,13 @@ def parse_runparams_from_ports(ports_queryset): # TODO: how to ensure the correct number of Port items? Should be 1 param_port = ports_queryset.filter(name = "runparams").first() runparams = {} - runparams['project_prefix'] = param_port.value['project_prefix'] + runparams['project_prefix'] = param_port.value['project_prefix'][0] # NOTE: comes in as array but need single string runparams['genome'] = param_port.value['genome'] runparams['scripts_bin'] = param_port.value['scripts_bin'] # TODO: find a way to handle runparams['pi'] = "NA" - runparams['pi-email'] = "NA" + runparams['pi_email'] = "NA" return(runparams) def get_db_files(assay, references_json = "runner/operator/roslin_operator/reference_jsons/roslin_resources.json"): @@ -271,12 +305,21 @@ def build_inputs_from_runs(run_queryset, _assay = None): db_files = get_db_files(assay) ref_fasta = db_files.pop('ref_fasta') + # get the .bam files needed for QC input + bams = parse_bams_from_ports(ports) + + # convert to CWL output format + bams_cwl = bams_to_cwl(bams) + # build the final data dict for QC input qc_input = {} qc_input['db_files'] = db_files qc_input['runparams'] = runparams qc_input['pairs'] = pairs_cwl qc_input['ref_fasta'] = ref_fasta + qc_input['bams'] = bams_cwl + qc_input['directories'] = [] + qc_input['files'] = [] qc_input = {**qc_input, **input_files} return(qc_input) diff --git a/runner/tests/operator/roslin_qc_operator/test_input.py b/runner/tests/operator/roslin_qc_operator/test_input.py index 03d6e9b08..798c6be94 100644 --- a/runner/tests/operator/roslin_qc_operator/test_input.py +++ b/runner/tests/operator/roslin_qc_operator/test_input.py @@ -19,6 +19,7 @@ from runner.operator.roslin_qc_operator.bin.input import path_to_cwl from runner.operator.roslin_qc_operator.bin.input import build_sample from runner.operator.roslin_qc_operator.bin.input import pair_to_cwl +from runner.operator.roslin_qc_operator.bin.input import parse_bams_from_ports from pprint import pprint class TestInput(TestCase): @@ -141,6 +142,21 @@ def test_parse_pairs_from_ports1(self): }] self.assertEqual(pairs, expected_pairs) + def test_parse_bams_from_ports1(self): + """ + Test that the 'bams' entries are constructed correctly from the Port objects + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + run_instance = Run.objects.first() + ports = run_instance.port_set.all() + bams = parse_bams_from_ports(ports) + expected_bams = [[ + File.objects.get(file_name = 's_C_K2902H_P001_d.rg.md.abra.printreads.bam'), + File.objects.get(file_name = 's_C_K2902H_N001_d.rg.md.abra.printreads.bam') + ]] + self.assertEqual(bams, expected_bams) # TODO: need to figure out how this will be handled; need the sample metadata associated with .bam files + def test_pair_to_cwl1(self): """ Test conversion of single pair to base CWL datastructure format @@ -209,8 +225,8 @@ def test_parse_runparams_from_ports1(self): runparams = parse_runparams_from_ports(ports) expected_runparams = {'genome': 'GRCh37', 'pi': 'NA', - 'pi-email': 'NA', - 'project_prefix': ['09670_D'], + 'pi_email': 'NA', + 'project_prefix': '09670_D', 'scripts_bin': '/usr/bin'} self.assertEqual(runparams, expected_runparams) @@ -265,9 +281,37 @@ def test_build_inputs_from_run_and_ports1(self): # load test pipeline Run output fixtures test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") call_command('loaddata', test_files_fixture, verbosity=0) + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) run_queryset = Run.objects.all() qc_input = build_inputs_from_runs(run_queryset) + print(">>> printing qc_input to file") + print(json.dumps(qc_input, indent = 4), file = open("qc_input.json", 'w')) + self.assertTrue(False) # TODO: finish work here + + def test_load_extra_fixtures(self): + """ + Sanity test to ensure that our fixtures have not changed + """ + self.assertEqual(len(Run.objects.all()), 0) + self.assertEqual(len(Port.objects.all()), 0) + self.assertEqual(len(File.objects.all()), 0) + self.assertEqual(len(FileMetadata.objects.all()), 0) + + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + + self.assertEqual(len(Run.objects.all()), 1) + self.assertEqual(len(Port.objects.all()), 47) + self.assertEqual(len(File.objects.all()), 121) + self.assertEqual(len(FileMetadata.objects.all()), 121) + + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) - # print(json.dumps(qc_input, indent = 4)) + self.assertEqual(len(Run.objects.all()), 2) + self.assertEqual(len(Port.objects.all()), 94) + self.assertEqual(len(File.objects.all()), 242) + self.assertEqual(len(FileMetadata.objects.all()), 242) diff --git a/scripts/dump_db_fixtures.py b/scripts/dump_db_fixtures.py index 9d32e49ef..0884b9ccc 100755 --- a/scripts/dump_db_fixtures.py +++ b/scripts/dump_db_fixtures.py @@ -239,6 +239,14 @@ def dump_file(**kwargs): output_file = "all.file_filemetadata.json" print(json.dumps(all_data, indent=4), file = open(output_file, "w")) +def dump_file_group(**kwargs): + """ + Dump the FileGroup fixtures + """ + fileGroupId = kwargs.pop('fileGroupID') + output_file_group_file = "{}.file_group.json".format(fileGroupId) + filegroup_instance = FileGroup.objects.get(id = fileGroupId) + print(json.dumps(json.loads(serializers.serialize('json', [filegroup_instance])), indent=4), file = open(output_file_group_file, "w")) def parse(): """ @@ -272,6 +280,10 @@ def parse(): port_files.add_argument('portID', help = 'Port ID to dump files for') port_files.set_defaults(func = dump_port_files) + file_group = subparsers.add_parser('filegroup', help = 'Dump filegroup fixture') + file_group.add_argument('fileGroupID', help = 'FileGroup ID ID to dump items for') + file_group.set_defaults(func = dump_file_group) + args = parser.parse_args() args.func(**vars(args)) diff --git a/scripts/duplicate_fixtures.py b/scripts/duplicate_fixtures.py index e1454a3ec..152098619 100755 --- a/scripts/duplicate_fixtures.py +++ b/scripts/duplicate_fixtures.py @@ -18,12 +18,14 @@ ----- The input .json file must have been produced with 'indent = 4' or have equivalent indenting, or this script will probably not work """ +import os import sys import json import uuid import copy import re import time +import argparse def get_unique_id(): """ @@ -35,7 +37,7 @@ def get_unique_id(): """ return(uuid.uuid1()) -def replace_primary_keys(input_file): +def replace_primary_keys(input_file, no_change_files): """ Replaces all primary keys in the file with new values """ @@ -43,7 +45,14 @@ def replace_primary_keys(input_file): all_pk = [] with open(input_file) as f: for item in json.load(f): - all_pk.append(item['pk']) + # do not change the pk's on 'File' objects because that causes unique constraint issues on file path + if item['model'] != 'file_system.file': + all_pk.append(item['pk']) + elif item['model'] == 'file_system.file': + if no_change_files == True: + pass + elif no_change_files == False: + all_pk.append(item['pk']) # sort unique based on descending length # this makes sure we replace the longer pattern first in the next steps @@ -124,25 +133,48 @@ def replace_field_value(input_lines, field_name, old_value, new_value): output_lines[i] = new_line return(output_lines) -def main(input_file): +def main(**kwargs): """ Main function for editing a fixtures file to replace all old primary keys with new keys So that both old and new fixtures sets can be loaded into the database at the same time """ - output_file_name = "{}.duplicated.json".format(input_file) + input_file = kwargs.pop('input_file') + output_file = kwargs.pop('output_file', None) + no_change_files = kwargs.pop('output_file', False) + + if output_file == None: + output_file_name = "{}.duplicated.json".format(input_file) + else: + output_file_name = output_file # generate a timestamp string to use for new unique identifiers timestamp_str = str(int(time.time())) # replace all the primary keys with new values; need special handling for pk's because they do not always have a field label in the file - output_lines = replace_primary_keys(input_file) + output_lines = replace_primary_keys(input_file, no_change_files) # replace the values for all of these other desired fields; these fields are always clearly labeled in the file so they are easy to find - for field_name in ['runId', 'requestId', 'sampleId', 'patientId', 'sampleName', 'externalSampleId', 'investigatorSampleId']: + fields_to_change = [ + 'runId', + 'requestId', + 'sampleId', + 'patientId', + 'sampleName', + 'externalSampleId', + 'investigatorSampleId', + 'file_name', + 'path' + ] + for field_name in fields_to_change: all_values = get_field_values(input_lines = output_lines, field_name = field_name) for old_value in all_values: # make a new value by appending the timestamp - new_value = old_value + '_' + timestamp_str + if field_name in ['file_name', 'path']: + # special handling for adding timestamp to file paths + name, ext = os.path.splitext(old_value) + new_value = name + '.' + timestamp_str + ext + else: + new_value = old_value + '_' + timestamp_str output_lines = replace_field_value(input_lines = output_lines, field_name = field_name, old_value = old_value, new_value = new_value) # save the output files @@ -154,8 +186,13 @@ def parse(): Parses script args Script arg parsing will go here as this script grows """ - input_file = sys.argv[1] - main(input_file) + parser = argparse.ArgumentParser(description = 'Duplicate database fixtures that were previously dumped in json format with indentation') + parser.add_argument('input_file', help = "Input file containing fixtures") + parser.add_argument('--output-file', dest = "output_file", default = None, help = "Name of output file to write to") + parser.add_argument('--no-change-files', dest = "no_change_files", action = 'store_true', help = "Dont change the File items' primary keys and paths") + + args = parser.parse_args() + main(**vars(args)) if __name__ == '__main__': parse() From 300bea2399f75a078287b3f1361fd4139c2b2b1a Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Tue, 18 Feb 2020 13:54:56 -0500 Subject: [PATCH 09/31] add RoslinQCOperator to get by classname for Operator Factory --- runner/operator/operator_factory.py | 1 + .../test_roslin_qc_operator.py | 19 ++++++++++++++----- 2 files changed, 15 insertions(+), 5 deletions(-) diff --git a/runner/operator/operator_factory.py b/runner/operator/operator_factory.py index fd162bf09..4b88be9c1 100644 --- a/runner/operator/operator_factory.py +++ b/runner/operator/operator_factory.py @@ -9,6 +9,7 @@ class OperatorFactory(object): "TempoOperator": TempoOperator, "RoslinOperator": RoslinOperator, "AccessOperator": AccessOperator, + "RoslinQcOperator": RoslinQcOperator } def get_by_class_name(class_name, request_id): diff --git a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py index 7373ffdae..d593eb11f 100644 --- a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py +++ b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py @@ -5,19 +5,28 @@ from runner.operator.operator_factory import OperatorFactory from runner.operator.roslin_qc_operator.roslin_qc_operator import RoslinQcOperator class TestOperatorFactory(TestCase): - def test_true(self): - self.assertTrue(True) - def test_operator_factory_roslin_qc1(self): """ Test that a Roslin QC operator instance can be created """ pipeline_type = "roslin-qc" - request_id = "bar" + request_id = "foo" operator = OperatorFactory.factory(pipeline_type, request_id) self.assertTrue(isinstance(operator, RoslinQcOperator)) self.assertTrue( operator.pipeline_id == "replace-this-with-pipeline-id") self.assertTrue( operator.operator == "roslin-qc") - self.assertTrue( operator.request_id == "bar") + self.assertTrue( operator.request_id == "foo") + self.assertTrue( operator._jobs == []) + self.assertTrue( len(operator.files) == 0) + + def test_operator_factory_get_by_class_name(self): + """ + Test that you can get the RoslinQC operator by name + """ + operator = OperatorFactory.get_by_class_name("RoslinQcOperator", "foo") + self.assertTrue(isinstance(operator, RoslinQcOperator)) + self.assertTrue( operator.pipeline_id == "replace-this-with-pipeline-id") + self.assertTrue( operator.operator == "roslin-qc") + self.assertTrue( operator.request_id == "foo") self.assertTrue( operator._jobs == []) self.assertTrue( len(operator.files) == 0) From de584045bdbaf344b0da5d0580c297f648fccb0b Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 19 Feb 2020 13:14:05 -0500 Subject: [PATCH 10/31] make Roslin operator data easier to read --- runner/operator/roslin_operator/roslin_operator.py | 10 +++++++--- 1 file changed, 7 insertions(+), 3 deletions(-) diff --git a/runner/operator/roslin_operator/roslin_operator.py b/runner/operator/roslin_operator/roslin_operator.py index 51ffc526a..6bde5d237 100644 --- a/runner/operator/roslin_operator/roslin_operator.py +++ b/runner/operator/roslin_operator/roslin_operator.py @@ -47,7 +47,11 @@ def get_jobs(self): tumor_sample_name = job['pair'][0]['ID'] normal_sample_name = job['pair'][1]['ID'] name = "ROSLIN %s, %i of %i" % (self.request_id, i + 1, number_of_inputs) - roslin_jobs.append((APIRunCreateSerializer( - data={'app': self.get_pipeline_id(), 'inputs': roslin_inputs, 'name': name, - 'tags': {'requestId': self.request_id}}), job)) + data={ + 'app': self.get_pipeline_id(), + 'inputs': roslin_inputs, + 'name': name, + 'tags': {'requestId': self.request_id} + } + roslin_jobs.append( (APIRunCreateSerializer(data), job) ) return roslin_jobs From e9670d1b2c0ae6166ad1807e3c25a64d03f7ac5d Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 19 Feb 2020 13:17:49 -0500 Subject: [PATCH 11/31] update Makefile and operator tests --- Makefile | 3 ++- runner/tests/operator/test_operator.py | 3 --- runner/tests/operator/test_operator_factory.py | 9 +++++++++ 3 files changed, 11 insertions(+), 4 deletions(-) diff --git a/Makefile b/Makefile index 6c0942b28..53fca5575 100644 --- a/Makefile +++ b/Makefile @@ -437,13 +437,14 @@ file-get: http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/fs/files/?filename=$(REQFILE) # start a Roslin run for a given request in the Beagle db +PIPELINE:=roslin run-request: $(AUTH_FILE) token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ echo ">>> token: $$token" && \ curl -H "Content-Type: application/json" \ -X POST \ -H "Authorization: Bearer $$token" \ - --data '{"request_ids":["$(REQID)"], "pipeline_name": "roslin"}' \ + --data '{"request_ids":["$(REQID)"], "pipeline_name": "$(PIPELINE)"}' \ http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/run/request/ # send a pipeline input to the API to start running diff --git a/runner/tests/operator/test_operator.py b/runner/tests/operator/test_operator.py index 35b790e17..a17bea0fb 100755 --- a/runner/tests/operator/test_operator.py +++ b/runner/tests/operator/test_operator.py @@ -5,9 +5,6 @@ from runner.operator.operator import Operator class TestOperator(TestCase): - def test_true(self): - self.assertTrue(True) - def test_operator_instance(self): """ Test that an Operator instance can be created and it has the correct attributes diff --git a/runner/tests/operator/test_operator_factory.py b/runner/tests/operator/test_operator_factory.py index b0f353e5f..8eaa69c66 100755 --- a/runner/tests/operator/test_operator_factory.py +++ b/runner/tests/operator/test_operator_factory.py @@ -13,3 +13,12 @@ def test_operator_factory_invalid_pipeline1(self): pipeline_type = "foo" request_id = "bar" self.assertRaises(Exception, OperatorFactory.factory, pipeline_type, request_id) + + def test_no_requestID(self): + """ + Test that an operator can be returned without a requestID + """ + pipeline_type = "roslin" + request_id = None + operator = OperatorFactory.factory(pipeline_type, request_id) + self.assertEqual(operator.request_id, request_id) From 30284a2e8d15bd5f16d1e9cd02addf267f4bcbbb Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 19 Feb 2020 13:56:43 -0500 Subject: [PATCH 12/31] add roslin qc pipeline fixture --- runner/fixtures/runner.pipeline.json | 14 ++++++++++++++ 1 file changed, 14 insertions(+) diff --git a/runner/fixtures/runner.pipeline.json b/runner/fixtures/runner.pipeline.json index 5fc827184..cecb81b35 100644 --- a/runner/fixtures/runner.pipeline.json +++ b/runner/fixtures/runner.pipeline.json @@ -54,5 +54,19 @@ "output_file_group": "a66f03b4-ce43-40d0-9134-d5a3575cabae", "output_directory": "/juno/work/pi/beagle/output/flatbush" } + }, + { + "model": "runner.pipeline", + "pk": "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a", + "fields": { + "created_date": "2019-11-18T17:46:45.118Z", + "modified_date": "2019-12-05T01:12:39.854Z", + "name": "roslin-qc", + "github": "https://github.com/mskcc/roslin-cwl", + "version": "1.0.0-rc5", + "entrypoint": "modules/project/generate-qc.cwl", + "output_file_group": "a975f490-1b02-4575-abae-a4f8e3667733", + "output_directory": "/juno/work/pi/beagle/output/roslin-qc" + } } ] From 84d182a4f3af4022ffbf66f8cd29d4e926d7d690 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 19 Feb 2020 15:05:50 -0500 Subject: [PATCH 13/31] clean up Roslin operator --- runner/operator/roslin_operator/roslin_operator.py | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/runner/operator/roslin_operator/roslin_operator.py b/runner/operator/roslin_operator/roslin_operator.py index 6bde5d237..a7803319c 100644 --- a/runner/operator/roslin_operator/roslin_operator.py +++ b/runner/operator/roslin_operator/roslin_operator.py @@ -6,7 +6,6 @@ from .bin.pair_request import compile_pairs from .bin.make_sample import build_sample - class RoslinOperator(Operator): def __init__(self, request_id): @@ -47,11 +46,12 @@ def get_jobs(self): tumor_sample_name = job['pair'][0]['ID'] normal_sample_name = job['pair'][1]['ID'] name = "ROSLIN %s, %i of %i" % (self.request_id, i + 1, number_of_inputs) - data={ + data = { 'app': self.get_pipeline_id(), 'inputs': roslin_inputs, 'name': name, 'tags': {'requestId': self.request_id} } - roslin_jobs.append( (APIRunCreateSerializer(data), job) ) + run = APIRunCreateSerializer(data = data) + roslin_jobs.append((run, job)) return roslin_jobs From 5eccbf1b94c12f30fc4c09791a7b2467793f1eb5 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 19 Feb 2020 16:57:35 -0500 Subject: [PATCH 14/31] add sorting to QC inputs for reproducibility --- Makefile | 5 ++++- runner/operator/roslin_qc_operator/bin/input.py | 5 +++-- runner/tests/views/test_run_api_view.py | 1 - 3 files changed, 7 insertions(+), 4 deletions(-) diff --git a/Makefile b/Makefile index 53fca5575..793ae79ab 100644 --- a/Makefile +++ b/Makefile @@ -316,9 +316,12 @@ export DJ_DEBUG_LOG:=$(LOG_DIR_ABS)/dj.debug.log # initialize the Django app in the database # do this after setting up the db above django-init: - python manage.py makemigrations --merge + python manage.py makemigrations # --merge python manage.py migrate + $(MAKE) djano-load-fixtures python manage.py createsuperuser + +djano-load-fixtures: python manage.py loaddata \ file_system.filegroup.json \ file_system.filetype.json \ diff --git a/runner/operator/roslin_qc_operator/bin/input.py b/runner/operator/roslin_qc_operator/bin/input.py index 2638c054d..f0ad51ee9 100644 --- a/runner/operator/roslin_qc_operator/bin/input.py +++ b/runner/operator/roslin_qc_operator/bin/input.py @@ -91,7 +91,8 @@ def create_files_data_from_ports_with_names(ports): # TODO: use a Django query instead of iteration files = [] for port in ports: - for file in port.files.all(): + # arbitrary ordering to force a test-able output + for file in port.files.all().order_by('path'): file_cwl = file_to_cwl(file) d = { 'name': port.name, 'file': file_cwl } files.append(d) @@ -275,7 +276,7 @@ def build_inputs_from_runs(run_queryset, _assay = None): Build the Roslin QC pipeline inputs data structure from a set of Roslin Voyager pipeline Run instances """ # get the input and output Ports of the run - ports = Port.objects.filter(run__in = run_queryset) + ports = Port.objects.filter(run__in = run_queryset).order_by('created_date') # arbitrary ordering to force a test-able output # get the list of tumor normal pairs out of the Ports pairs = parse_pairs_from_ports(ports) diff --git a/runner/tests/views/test_run_api_view.py b/runner/tests/views/test_run_api_view.py index f145f393f..5b03b16fd 100644 --- a/runner/tests/views/test_run_api_view.py +++ b/runner/tests/views/test_run_api_view.py @@ -3,7 +3,6 @@ """ import os from mock import patch -from unittest.mock import Mock from django.test import TestCase from runner.views.run_api_view import OperatorViewSet from runner.models import Run From 851ad778055e68d0f134e48427f069dd1a56bab3 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 19 Feb 2020 17:32:51 -0500 Subject: [PATCH 15/31] update Roslin qc operator and tests --- .../roslin_qc_operator/roslin_qc_operator.py | 73 ++++++++++++++++++- .../test_roslin_qc_operator.py | 72 ++++++++++++++++-- 2 files changed, 136 insertions(+), 9 deletions(-) diff --git a/runner/operator/roslin_qc_operator/roslin_qc_operator.py b/runner/operator/roslin_qc_operator/roslin_qc_operator.py index 85ebab5dd..4c267c7c4 100644 --- a/runner/operator/roslin_qc_operator/roslin_qc_operator.py +++ b/runner/operator/roslin_qc_operator/roslin_qc_operator.py @@ -1,16 +1,81 @@ from runner.operator.operator import Operator +from runner.models import Run, Pipeline, Run, RunStatus +from runner.serializers import APIRunCreateSerializer +from .bin import input +import datetime + +class InvalidPipelineError(Exception): + pass class RoslinQcOperator(Operator): """ Operator for Roslin QC pipeline """ - def __init__(self, request_id): + def __init__(self, request_id = None, run_ids = None): + self.run_ids = run_ids + self.runs = None + if self.run_ids != None: + self.runs = Run.objects.filter(id__in = self.run_ids) + # TODO: add support for things like FileMetadata's + # TODO: add support for multiple request ids + Operator.__init__(self, 'roslin-qc', request_id) def get_pipeline_id(self): - # TODO: replace this with the hard-coded pipeline id that will be created in database fixture - return "replace-this-with-pipeline-id" + return "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a" + + def get_input_data(self): + """ + Build up the data to use for input to QC pipeline + Needs to match the datastructure expected by the CWL pipeline input + + TODO: fill this in with handling of more types of input criteria; runs, requests, FileMetadata's, etc + """ + input_data = {} + if self.runs != None: + input_data = input.build_inputs_from_runs(self.runs) + # TODO: add methods here to add data from other items like requests, FileMetadata, etc + return(input_data) + + def get_output_metadata(self): + """ + Implement methods here to generate output metadata values that might need to be passed + """ + return({}) + + def get_data_for_serializer(self, input_data, output_metadata, create_date = None, name = None, tags = None, pipeline_id = None): + """ + Put together the data that will be sent to the serializer for run creation + """ + if create_date == None: + create_date = datetime.datetime.now().strftime("%m/%d/%Y, %H:%M:%S") + + if name == None: + name = "Roslin QC {create_date}".format(create_date = create_date) + + if tags == None: + tags = {} + if self.request_id: + tags['request_id'] = self.request_id + if self.run_ids: + tags['run_ids'] = self.run_ids + + if pipeline_id == None: + pipeline_id = self.get_pipeline_id() + + serializer_data = { + 'app': pipeline_id, + 'inputs': input_data, + 'name': name, + 'tags': tags, + 'output_metadata': output_metadata + } + return(serializer_data) def get_jobs(self): - return([]) + input_data = self.get_input_data() + output_metadata = self.get_output_metadata() + serializer_data = self.get_data_for_serializer(input_data, output_metadata) + run = APIRunCreateSerializer(data = serializer_data) + return([(run, input_data)]) diff --git a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py index d593eb11f..5968b9953 100644 --- a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py +++ b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py @@ -1,19 +1,34 @@ """ Tests for Roslin QC Operator class """ +import os +import json +from mock import patch from django.test import TestCase from runner.operator.operator_factory import OperatorFactory from runner.operator.roslin_qc_operator.roslin_qc_operator import RoslinQcOperator -class TestOperatorFactory(TestCase): +from django.conf import settings +from django.core.management import call_command +from runner.models import Pipeline, Run +from runner.tasks import create_run_task + +class TestRoslinQcOperator(TestCase): + fixtures = [ + "file_system.filegroup.json", + "file_system.filetype.json", + "file_system.storage.json", + "runner.pipeline.json" + ] + def test_operator_factory_roslin_qc1(self): """ - Test that a Roslin QC operator instance can be created + Test that a Roslin QC operator instance can be created with Operator.factory """ pipeline_type = "roslin-qc" request_id = "foo" operator = OperatorFactory.factory(pipeline_type, request_id) self.assertTrue(isinstance(operator, RoslinQcOperator)) - self.assertTrue( operator.pipeline_id == "replace-this-with-pipeline-id") + self.assertTrue( operator.pipeline_id == "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a") self.assertTrue( operator.operator == "roslin-qc") self.assertTrue( operator.request_id == "foo") self.assertTrue( operator._jobs == []) @@ -21,12 +36,59 @@ def test_operator_factory_roslin_qc1(self): def test_operator_factory_get_by_class_name(self): """ - Test that you can get the RoslinQC operator by name + Test that you can get the RoslinQC operator by Operator.get_by_class_name """ operator = OperatorFactory.get_by_class_name("RoslinQcOperator", "foo") self.assertTrue(isinstance(operator, RoslinQcOperator)) - self.assertTrue( operator.pipeline_id == "replace-this-with-pipeline-id") + self.assertTrue( operator.pipeline_id == "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a") self.assertTrue( operator.operator == "roslin-qc") self.assertTrue( operator.request_id == "foo") self.assertTrue( operator._jobs == []) self.assertTrue( len(operator.files) == 0) + + # disable job submission to Ridgeback + @patch('runner.tasks.submit_job') + def test_direct_operator_creation(self, submit_job): + """ + Test direct Operator instantiation without Operator Factory + """ + # self.maxDiff = None + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + + # create the operator instance + operator = RoslinQcOperator(request_id = None, run_ids = ['ca18b090-03ad-4bef-acd3-52600f8e62eb']) + + # check its attributes + self.assertEqual(operator.run_ids, ['ca18b090-03ad-4bef-acd3-52600f8e62eb']) + self.assertEqual(operator.get_pipeline_id(), "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a") + + # create the data for the operator run + input_data = operator.get_input_data() + expected_input_data = json.load(open(os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.roslin-qc.input.json"))) + + output_metadata = operator.get_output_metadata() + serializer_data = operator.get_data_for_serializer(input_data, output_metadata, name = "foo name") + + # check qualities of the data generated + # need to pass data through JSON because loaded JSON fixtures do not represent Python tuples embedded in data + self.assertEqual(json.loads(json.dumps(input_data)), expected_input_data) + self.assertEqual(output_metadata, {}) + + expected_serializer_data = { + 'app': "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a", + 'inputs': input_data, + 'name': "foo name", + 'tags': {'run_ids':['ca18b090-03ad-4bef-acd3-52600f8e62eb']}, + 'output_metadata': output_metadata + } + self.assertEqual(serializer_data, expected_serializer_data) + + # create a run with the data + self.assertEqual(len(Run.objects.all()), 1) + jobs = operator.get_jobs() + for job in jobs: + if job[0].is_valid(): + run = job[0].save() + create_run_task(str(run.id), job[1], None) + self.assertEqual(len(Run.objects.all()), 2) From cdeb92d20383e69f6382b54133b766f4102cdedf Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Thu, 20 Feb 2020 11:34:32 -0500 Subject: [PATCH 16/31] disable bid to cwl conversion since its handled elsewhere --- runner/operator/roslin_qc_operator/bin/input.py | 12 ++++++------ 1 file changed, 6 insertions(+), 6 deletions(-) diff --git a/runner/operator/roslin_qc_operator/bin/input.py b/runner/operator/roslin_qc_operator/bin/input.py index f0ad51ee9..ce42274e4 100644 --- a/runner/operator/roslin_qc_operator/bin/input.py +++ b/runner/operator/roslin_qc_operator/bin/input.py @@ -231,12 +231,12 @@ def get_db_files(assay, references_json = "runner/operator/roslin_operator/refer db_files['ref_fasta'] = references["request_files"]['ref_fasta'] # check for URI ref_fasta; 'juno:///juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta' - for key, value in db_files.items(): - if value.startswith('juno:///'): - parts = urllib.parse.urlsplit(value) - db_files[key] = path_to_cwl(parts.path) - elif value.startswith('/'): - db_files[key] = path_to_cwl(value) + # for key, value in db_files.items(): + # if value.startswith('juno:///'): + # parts = urllib.parse.urlsplit(value) + # db_files[key] = path_to_cwl(parts.path) + # elif value.startswith('/'): + # db_files[key] = path_to_cwl(value) # TODO: what to do if its not either of these cases? return(db_files) From 40869d43bd90e3f0082bf319a042d1a803495767 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Thu, 20 Feb 2020 12:57:15 -0500 Subject: [PATCH 17/31] remove CWL conversion --- runner/operator/roslin_qc_operator/bin/input.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/runner/operator/roslin_qc_operator/bin/input.py b/runner/operator/roslin_qc_operator/bin/input.py index ce42274e4..13fc0d6f2 100644 --- a/runner/operator/roslin_qc_operator/bin/input.py +++ b/runner/operator/roslin_qc_operator/bin/input.py @@ -93,8 +93,8 @@ def create_files_data_from_ports_with_names(ports): for port in ports: # arbitrary ordering to force a test-able output for file in port.files.all().order_by('path'): - file_cwl = file_to_cwl(file) - d = { 'name': port.name, 'file': file_cwl } + # file_cwl = file_to_cwl(file) + d = { 'name': port.name, 'file': file } files.append(d) return(files) From 2787baaa62e4ed4a6f059be18607beb17e2c17a8 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Mon, 24 Feb 2020 11:28:53 -0500 Subject: [PATCH 18/31] refactor job data generation methods --- .../operator/roslin_qc_operator/bin/input.py | 89 ++++++++++++++++--- .../operator/roslin_qc_operator/test_input.py | 88 ++++++++++++++++-- 2 files changed, 162 insertions(+), 15 deletions(-) diff --git a/runner/operator/roslin_qc_operator/bin/input.py b/runner/operator/roslin_qc_operator/bin/input.py index 13fc0d6f2..e50f4c44e 100644 --- a/runner/operator/roslin_qc_operator/bin/input.py +++ b/runner/operator/roslin_qc_operator/bin/input.py @@ -66,6 +66,20 @@ def file_to_cwl(file_instance): } return(d) +def file_to_job_data(file_instance): + """ + Convert a Beagle File instance into a dict that will be used in the Job submitted to Beagle + NOTE: this is not the same as the CWL output format + + example: + {'class': 'File', 'location': 'juno://path/to/foo.txt'} + """ + d = { + 'class': 'File', + 'location': 'juno://%s' % file_instance.path + } + return(d) + def path_to_cwl(filepath): """ Convert a filepath string into a CWL File format dict @@ -76,6 +90,17 @@ def path_to_cwl(filepath): } return(d) +def path_to_job_data(filepath): + """ + Convert a filepath to a string representation for Job submission data` + NOTE: not the same format as CWL representation + """ + d = { + 'class': 'File', + 'location': 'juno://%s' % filepath + } + return(d) + def get_assay_from_run(run_instance): """ Return the assay from a Run instance @@ -93,8 +118,8 @@ def create_files_data_from_ports_with_names(ports): for port in ports: # arbitrary ordering to force a test-able output for file in port.files.all().order_by('path'): - # file_cwl = file_to_cwl(file) - d = { 'name': port.name, 'file': file } + file_cwl = file_to_job_data(file) + d = { 'name': port.name, 'file': file_cwl } files.append(d) return(files) @@ -188,6 +213,39 @@ def pair_to_cwl(pair): output = (tumor, normal) return(output) +def pair_to_job_data(pair): + """ + Convert a single tumor normal pair dict to Job submission data format + NOTE: not the same as CWL format + + pair = { + 'normal': { + 'R1': FileMetadata, + 'R2': FileMetadata + }, + 'tumor': { + 'R1': FileMetadata, + 'R2': FileMetadata + } + """ + # get the base datastructure dict for each R1 and R2 + normal_r1 = build_sample(pair['normal']['R1']) + normal_r2 = build_sample(pair['normal']['R2']) + tumor_r1 = build_sample(pair['tumor']['R1']) + tumor_r2 = build_sample(pair['tumor']['R2']) + + # merge the dict's; the second dict will overwrite args from the first + normal = {**normal_r1, **normal_r2} + normal['R1'] = file_to_job_data(pair['normal']['R1'].file) + normal['R2'] = file_to_job_data(pair['normal']['R2'].file) + + tumor = {**tumor_r1, **tumor_r2} + tumor['R1'] = file_to_job_data(pair['tumor']['R1'].file) + tumor['R2'] = file_to_job_data(pair['tumor']['R2'].file) + + output = (tumor, normal) + return(output) + def bams_to_cwl(bams): """ Convert the items in the bams list to CWL format @@ -198,8 +256,8 @@ def bams_to_cwl(bams): for item in bams: tumor_bam = item[0] normal_bam = item[1] - tumor_bam_cwl = file_to_cwl(tumor_bam) - normal_bam_cwl = file_to_cwl(normal_bam) + tumor_bam_cwl = file_to_job_data(tumor_bam) + normal_bam_cwl = file_to_job_data(normal_bam) bam_cwls.append([tumor_bam_cwl, normal_bam_cwl]) return(bam_cwls) @@ -230,13 +288,24 @@ def get_db_files(assay, references_json = "runner/operator/roslin_operator/refer db_files['conpair_markers'] = references["request_files"]['conpair_markers'] db_files['ref_fasta'] = references["request_files"]['ref_fasta'] + # need to resolve some items to URI's + for key in ['fp_genotypes', 'hotspot_list_maf', 'ref_fasta']: + value = db_files[key] + if value.startswith('juno:///'): + parts = urllib.parse.urlsplit(value) + db_files[key] = path_to_job_data(parts.path) + elif value.startswith('/'): + db_files[key] = path_to_job_data(db_files[key]) + # TODO: do these need to be changed?? + # check for URI ref_fasta; 'juno:///juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta' # for key, value in db_files.items(): # if value.startswith('juno:///'): - # parts = urllib.parse.urlsplit(value) - # db_files[key] = path_to_cwl(parts.path) + # pass + # # parts = urllib.parse.urlsplit(value) + # # db_files[key] = path_to_cwl(parts.path) # elif value.startswith('/'): - # db_files[key] = path_to_cwl(value) + # db_files[key] = path_to_job_data(value) # TODO: what to do if its not either of these cases? return(db_files) @@ -262,13 +331,13 @@ def parse_outputs_files_data(files_data): for item in files_data: item_type = item['name'] - file_cwl = item['file'] + file_data = item['file'] # append values for known keys # TODO: do we need to enforce unique-ness here? Do we need to enfore unique on file basename as well? if item_type in qc_input: - if file_cwl not in qc_input[item_type]: - qc_input[item_type].append(file_cwl) + if file_data not in qc_input[item_type]: + qc_input[item_type].append(file_data) return(qc_input) def build_inputs_from_runs(run_queryset, _assay = None): diff --git a/runner/tests/operator/roslin_qc_operator/test_input.py b/runner/tests/operator/roslin_qc_operator/test_input.py index 798c6be94..d8b6bf557 100644 --- a/runner/tests/operator/roslin_qc_operator/test_input.py +++ b/runner/tests/operator/roslin_qc_operator/test_input.py @@ -17,10 +17,12 @@ from runner.operator.roslin_qc_operator.bin.input import build_inputs_from_runs from runner.operator.roslin_qc_operator.bin.input import file_to_cwl from runner.operator.roslin_qc_operator.bin.input import path_to_cwl +from runner.operator.roslin_qc_operator.bin.input import path_to_job_data from runner.operator.roslin_qc_operator.bin.input import build_sample from runner.operator.roslin_qc_operator.bin.input import pair_to_cwl from runner.operator.roslin_qc_operator.bin.input import parse_bams_from_ports -from pprint import pprint +from runner.operator.roslin_qc_operator.bin.input import file_to_job_data +from runner.operator.roslin_qc_operator.bin.input import pair_to_job_data class TestInput(TestCase): fixtures = [ @@ -62,6 +64,7 @@ def test_validate_fixtures1(self): def test_file_to_cwl1(self): """ Test conversion of a File instance to an equivalent CWL entry + """ file_instance = File.objects.create( file_group = FileGroup.objects.first(), @@ -70,6 +73,10 @@ def test_file_to_cwl1(self): expected_file_cwl = {'class': 'File', 'path': '/path/to/foo.txt'} self.assertEqual(file_cwl, expected_file_cwl) + job_data = file_to_job_data(file_instance) + expected_job_data = {'class': 'File', 'location': 'juno:///path/to/foo.txt'} + self.assertEqual(job_data, expected_job_data) + def test_path_to_cwl1(self): """ Test conversion of a string based file path into CWL File format dict @@ -78,6 +85,10 @@ def test_path_to_cwl1(self): expected_file_cwl = {'class': 'File', 'path': '/path/to/foo.txt'} self.assertEqual(file_cwl, expected_file_cwl) + job_data = path_to_job_data('/path/to/foo.txt') + expected_job_data = {'class': 'File', 'location': 'juno:///path/to/foo.txt'} + self.assertEqual(job_data, expected_job_data) + def test_get_assay_from_run1(self): """ Test that correct assay is returned from fixture @@ -214,6 +225,64 @@ def test_pair_to_cwl1(self): 'tumor_type': 'Normal'}) self.assertEqual(pair_cwl, expected_pair_cwl) + def test_pair_to_job_data(self): + """ + Test that a pair dict is correctly converted to Job data for submission + """ + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + call_command('loaddata', test_files_fixture, verbosity=0) + pair = { + 'normal': { + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz")) + }, + 'tumor': { + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz")) + } + } + + job_data = pair_to_job_data(pair) + + expected_job_data = ({'CN': 'MSKCC', + 'ID': 'C-K2902H-P001-d_H7HCTBBXY', + 'LB': '09670_D_1_1_1_1_1', + 'PL': 'Illumina', + 'PU': 'H7HCTBBXY', + 'R1': {'class': 'File', + 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz'}, + 'R2': {'class': 'File', + 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz'}, + 'SM': 'C-K2902H-P001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_1', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-15', + 'species': 'Human', + 'specimen_type': 'Biopsy', + 'tumor_type': 'Tumor'}, + {'CN': 'MSKCC', + 'ID': 'C-K2902H-N001-d_H7FKJBBXY', + 'LB': '09670_D_46_1', + 'PL': 'Illumina', + 'PU': 'H7FKJBBXY', + 'R1': {'class': 'File', + 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz'}, + 'R2': {'class': 'File', + 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz'}, + 'SM': 'C-K2902H-N001-d', + 'bait_set': 'IDT_Exome_v1_FP_BAITS', + 'igo_id': '09670_D_46', + 'patient_id': 'C-K2902H', + 'request_id': '09670_D', + 'run_date': '2019-08-19', + 'species': 'Human', + 'specimen_type': 'Blood', + 'tumor_type': 'Normal'}) + + self.assertEqual(job_data, expected_job_data) + def test_parse_runparams_from_ports1(self): """ Test that runparams are correctly parsed from Port queryset @@ -237,10 +306,19 @@ def test_get_db_files(self): assay = "IDT_Exome_v1_FP_b37" db_files = get_db_files(assay) expected_db_files = { - 'conpair_markers': {'class': 'File', 'path': '/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt'}, - 'fp_genotypes': {'class': 'File', 'path': '/juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.txt'}, - 'hotspot_list_maf': {'class': 'File', 'path': '/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf'}, - 'ref_fasta': {'class': 'File', 'path': '/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta'} + 'conpair_markers': '/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt', + 'fp_genotypes': { + 'class': 'File', + 'location': 'juno:///juno/work/ci/resources/roslin_resources/targets/IDT_Exome_v1_FP/b37/FP_tiling_genotypes.txt' + }, + 'hotspot_list_maf': { + 'class': 'File', + 'location': 'juno:///juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf' + }, + 'ref_fasta': { + 'class': 'File', + 'location': 'juno:///juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta' + } } self.assertEqual(db_files, expected_db_files) From 0d2bc2be3f6e4602a75956016f0034488eb1cd98 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Mon, 24 Feb 2020 11:44:43 -0500 Subject: [PATCH 19/31] update Roslin QC operator tests --- .../test_roslin_qc_operator.py | 19 +++++++++++++++---- 1 file changed, 15 insertions(+), 4 deletions(-) diff --git a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py index 5968b9953..c81033d8a 100644 --- a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py +++ b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py @@ -11,6 +11,7 @@ from django.core.management import call_command from runner.models import Pipeline, Run from runner.tasks import create_run_task +from pprint import pprint class TestRoslinQcOperator(TestCase): fixtures = [ @@ -50,11 +51,13 @@ def test_operator_factory_get_by_class_name(self): @patch('runner.tasks.submit_job') def test_direct_operator_creation(self, submit_job): """ - Test direct Operator instantiation without Operator Factory + Test direct Operator instantiation without Operator Factory and try to create valid jobs """ # self.maxDiff = None test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") call_command('loaddata', test_files_fixture, verbosity=0) + test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "roslin_reference_files.json") + call_command('loaddata', test_files_fixture, verbosity=0) # create the operator instance operator = RoslinQcOperator(request_id = None, run_ids = ['ca18b090-03ad-4bef-acd3-52600f8e62eb']) @@ -65,15 +68,18 @@ def test_direct_operator_creation(self, submit_job): # create the data for the operator run input_data = operator.get_input_data() - expected_input_data = json.load(open(os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.roslin-qc.input.json"))) + # TODO: need way to recreate this for testing + # expected_input_data = json.load(open(os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.roslin-qc.input.json"))) output_metadata = operator.get_output_metadata() serializer_data = operator.get_data_for_serializer(input_data, output_metadata, name = "foo name") + # pprint(serializer_data, indent = 4, stream = open('roslin-qc-job.json', "w")) + # print(json.dumps(serializer_data, indent = 4), file = open('roslin-qc-job.json', "w")) # check qualities of the data generated # need to pass data through JSON because loaded JSON fixtures do not represent Python tuples embedded in data - self.assertEqual(json.loads(json.dumps(input_data)), expected_input_data) - self.assertEqual(output_metadata, {}) + # self.assertEqual(json.loads(json.dumps(input_data)), expected_input_data) + # self.assertEqual(output_metadata, {}) expected_serializer_data = { 'app': "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a", @@ -85,10 +91,15 @@ def test_direct_operator_creation(self, submit_job): self.assertEqual(serializer_data, expected_serializer_data) # create a run with the data + # make sure only 1 run exists before starting self.assertEqual(len(Run.objects.all()), 1) + + # create and validate the jobs then use them to create Runs jobs = operator.get_jobs() for job in jobs: if job[0].is_valid(): run = job[0].save() create_run_task(str(run.id), job[1], None) + + # make sure that a Run was made self.assertEqual(len(Run.objects.all()), 2) From e615bf44194bf7c1daf983d44eff800bf61a5120 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Mon, 24 Feb 2020 11:51:31 -0500 Subject: [PATCH 20/31] update test for input generation --- .../tests/operator/roslin_qc_operator/test_input.py | 11 ++++++++--- 1 file changed, 8 insertions(+), 3 deletions(-) diff --git a/runner/tests/operator/roslin_qc_operator/test_input.py b/runner/tests/operator/roslin_qc_operator/test_input.py index d8b6bf557..0f3cd1f65 100644 --- a/runner/tests/operator/roslin_qc_operator/test_input.py +++ b/runner/tests/operator/roslin_qc_operator/test_input.py @@ -365,9 +365,14 @@ def test_build_inputs_from_run_and_ports1(self): run_queryset = Run.objects.all() qc_input = build_inputs_from_runs(run_queryset) - print(">>> printing qc_input to file") - print(json.dumps(qc_input, indent = 4), file = open("qc_input.json", 'w')) - self.assertTrue(False) # TODO: finish work here + # print(">>> printing qc_input to file") + # print(json.dumps(qc_input, indent = 4), file = open("qc_input.json", 'w')) + # self.assertTrue(False) + # TODO: how to output format? + self.assertEqual(len(qc_input['pairs']), 2) + self.assertEqual(len(qc_input['pairs'][0]), 2) + self.assertEqual(len(qc_input['bams']), 2) + self.assertEqual(len(qc_input['bams'][0]), 2) def test_load_extra_fixtures(self): """ From c43cc7db4048bd61e16fe1a0f67d2659e78f50e5 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Tue, 25 Feb 2020 10:26:41 -0500 Subject: [PATCH 21/31] update serializer tests --- runner/tests/serializers/test_serializers.py | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/runner/tests/serializers/test_serializers.py b/runner/tests/serializers/test_serializers.py index 1ea9e5ff2..b9fb9238f 100644 --- a/runner/tests/serializers/test_serializers.py +++ b/runner/tests/serializers/test_serializers.py @@ -11,7 +11,8 @@ class TestSerializers(TestCase): "file_system.filegroup.json", "file_system.filetype.json", "file_system.storage.json", - "runner.pipeline.json" + "runner.pipeline.json", + "beagle_etl.operator.json" ] def test_create_run_serializer1(self): From 70e55aed8105e1091944e0697ceb383f27ded4a9 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Tue, 25 Feb 2020 10:52:24 -0500 Subject: [PATCH 22/31] update import recipe --- Makefile | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/Makefile b/Makefile index 1fe5955ba..26253f985 100644 --- a/Makefile +++ b/Makefile @@ -381,9 +381,10 @@ REQID:=07264_G TOKEN:=IUzI1NiJ9.eyJ0 # import files data about samples in a request from the IGO LIMS import: + token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ curl -H "Content-Type: application/json" \ -X POST \ - -H "Authorization: Bearer $(TOKEN)" \ + -H "Authorization: Bearer $$token" \ --data '{"request_ids":["$(REQID)"]}' \ http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/etl/import-requests/ From 188eddf5379ec08342b26ab69134bfad30a0281a Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Tue, 25 Feb 2020 10:55:41 -0500 Subject: [PATCH 23/31] move server log to logs dir --- Makefile | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/Makefile b/Makefile index 26253f985..d54d5f867 100644 --- a/Makefile +++ b/Makefile @@ -311,7 +311,7 @@ export DJANGO_RIDGEBACK_IP:=localhost export DJANGO_RIDGEBACK_PORT:=7001 export BEAGLE_RIDGEBACK_URL=http://$(DJANGO_RIDGEBACK_IP):$(DJANGO_RIDGEBACK_PORT) export DJ_DEBUG_LOG:=$(LOG_DIR_ABS)/dj.debug.log - +export BEAGLE_LOG_PATH:=$(LOG_DIR_ABS)/beagle-server.log # initialize the Django app in the database # do this after setting up the db above From fbd7acb6f4c599d46e43f13a6de2cb4a899916a9 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Tue, 25 Feb 2020 13:39:02 -0500 Subject: [PATCH 24/31] update API run view to support Run IDs, fixes #157 --- Makefile | 12 ++++++++++-- runner/views/run_api_view.py | 23 ++++++++++++++++++----- 2 files changed, 28 insertions(+), 7 deletions(-) diff --git a/Makefile b/Makefile index d54d5f867..70fa79cee 100644 --- a/Makefile +++ b/Makefile @@ -449,7 +449,6 @@ file-get: PIPELINE:=roslin run-request: $(AUTH_FILE) token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ - echo ">>> token: $$token" && \ curl -H "Content-Type: application/json" \ -X POST \ -H "Authorization: Bearer $$token" \ @@ -460,7 +459,6 @@ run-request: $(AUTH_FILE) REQJSON:=fixtures/tests/run_roslin.json run-request-api: $(AUTH_FILE) token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ - echo ">>> token: $$token" && \ curl -H "Content-Type: application/json" \ -X POST \ -H "Authorization: Bearer $$token" \ @@ -490,6 +488,16 @@ demo-run-api: register-dev-pipeline $(DEMO_INPUT) @python manage.py loaddata fixtures/tests/roslin_reference_files.json @$(MAKE) run-request-api REQID=DemoRequest1 REQJSON=$(DEMO_INPUT) +demo-roslin-qc: + python manage.py loaddata fixtures/tests/ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json && \ + token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ + curl -H "Content-Type: application/json" \ + -X POST \ + -H "Authorization: Bearer $$token" \ + --data '{"request_ids":[], "run_ids":["ca18b090-03ad-4bef-acd3-52600f8e62eb"], "pipeline_name": "roslin-qc"}' \ + http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/run/request/ +# python manage.py loaddata fixtures/tests/8f44d2f8-15c0-4d97-a966-6ad0b916bb41.run.ALN-REQ-ID.json && \ + # run the update-request endpoint for a request ID in order to update the metadata about a request update-request: @token=$$( jq -r '.token' "$(AUTH_FILE)" ) && \ diff --git a/runner/views/run_api_view.py b/runner/views/run_api_view.py index 028175838..f2b28eb50 100644 --- a/runner/views/run_api_view.py +++ b/runner/views/run_api_view.py @@ -18,7 +18,8 @@ from rest_framework.response import Response from rest_framework.viewsets import GenericViewSet from runner.tasks import create_jobs_from_request - +from beagle_etl.models import Operator +from runner.operator.roslin_qc_operator.roslin_qc_operator import RoslinQcOperator class RunApiViewSet(mixins.ListModelMixin, mixins.CreateModelMixin, @@ -92,13 +93,25 @@ class OperatorViewSet(GenericAPIView): logger = logging.getLogger(__name__) def post(self, request): - request_ids = request.data['request_ids'] + request_ids = request.data.get('request_ids', None) + run_ids = request.data.get('run_ids', None) pipeline_name = request.data['pipeline_name'] pipeline = get_object_or_404(Pipeline, name=pipeline_name) - for request_id in request_ids: - logging.info("Submitting requestId %s to pipeline %s" % (request_id, pipeline_name)) - create_jobs_from_request.delay(request_id, pipeline.operator_id) + if pipeline_name == "roslin-qc": + logging.info("Got roslin-qc pipeline for: request_ids: {request_ids}, run_ids: {run_ids}".format(request_ids = request_ids, run_ids = run_ids)) + # create the operator instance + roslin_qc_model = Operator.objects.get(slug="roslin-qc") + operator = RoslinQcOperator(roslin_qc_model, request_id = None, run_ids = run_ids) # TODO: need to handle all request_ids + jobs = operator.get_jobs() + for job in jobs: + if job[0].is_valid(): + run = job[0].save() + create_run_task.delay(str(run.id), job[1], None) + else: + for request_id in request_ids: + logging.info("Submitting requestId %s to pipeline %s" % (request_id, pipeline_name)) + create_jobs_from_request.delay(request_id, pipeline.operator_id) # tempo_operator = TempoOperator(request_id) # jobs = tempo_operator.get_jobs() # result = [] From b235fc6d59fa4c058dbcf90a52d9b0480079e393 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 26 Feb 2020 13:58:53 -0500 Subject: [PATCH 25/31] fix service checking in Makefile before trying to start server --- Makefile | 14 +++++++++----- 1 file changed, 9 insertions(+), 5 deletions(-) diff --git a/Makefile b/Makefile index 70fa79cee..286031f7c 100644 --- a/Makefile +++ b/Makefile @@ -273,7 +273,7 @@ celery-start: # check that the Celery processes are running celery-check: - -ps auxww | grep 'celery' | grep -v 'grep' | grep -v 'make' | grep '$(CURDIR)' + ps auxww | grep 'celery' | grep -v 'grep' | grep -v 'make' | grep '$(CURDIR)' # kill all the Celery processes started from this dir celery-stop: @@ -291,11 +291,14 @@ start-services: check-env $(MAKE) celery-start stop-services: - $(MAKE) celery-stop - $(MAKE) rabbitmq-stop - $(MAKE) db-stop - + -$(MAKE) celery-stop + -$(MAKE) rabbitmq-stop + -$(MAKE) db-stop +check-services: + $(MAKE) celery-check + $(MAKE) db-check + $(MAKE) rabbitmq-check # ~~~~~ Set Up Django ~~~~~ # export DJANGO_BEAGLE_IP:=localhost @@ -340,6 +343,7 @@ test-lims: check-env # start the Django development server runserver: check-env + if $(MAKE) check-services ; then : ; else echo ">>> ERROR: some services are not started"; exit 1 ; fi python manage.py runserver $(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT) MIGRATION_ARGS?= From 89d58b6f536549a12667e2fed7c7534b204e434a Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 26 Feb 2020 14:07:33 -0500 Subject: [PATCH 26/31] add job JSON dumping --- Makefile | 1 + beagle/settings.py | 1 + runner/tasks.py | 14 ++++++++++++++ 3 files changed, 16 insertions(+) diff --git a/Makefile b/Makefile index 286031f7c..ec726a5fe 100644 --- a/Makefile +++ b/Makefile @@ -315,6 +315,7 @@ export DJANGO_RIDGEBACK_PORT:=7001 export BEAGLE_RIDGEBACK_URL=http://$(DJANGO_RIDGEBACK_IP):$(DJANGO_RIDGEBACK_PORT) export DJ_DEBUG_LOG:=$(LOG_DIR_ABS)/dj.debug.log export BEAGLE_LOG_PATH:=$(LOG_DIR_ABS)/beagle-server.log +export DUMP_JSON:=False # initialize the Django app in the database # do this after setting up the db above diff --git a/beagle/settings.py b/beagle/settings.py index 1c8a54386..822c2fc63 100644 --- a/beagle/settings.py +++ b/beagle/settings.py @@ -316,3 +316,4 @@ PROJECT_DIR = os.path.dirname(os.path.realpath(__file__)) ROOT_DIR = os.path.dirname(PROJECT_DIR) TEST_FIXTURE_DIR = os.path.join(ROOT_DIR, "fixtures", "tests") +DUMP_JSON = os.environ.get('DUMP_JSON') == 'True' diff --git a/runner/tasks.py b/runner/tasks.py index 6ff2da3bb..3686c2d35 100644 --- a/runner/tasks.py +++ b/runner/tasks.py @@ -2,6 +2,7 @@ import uuid import logging import requests +import json from celery import shared_task from django.conf import settings from runner.run.objects.run_object import RunObject @@ -95,6 +96,9 @@ def process_triggers(): @shared_task def create_run_task(run_id, inputs, output_directory=None): logger.info("Creating and validating Run") + if settings.DUMP_JSON: + output_file_name = "{}.job.inputs.json".format(run_id) + print(json.dumps(inputs, indent = 4), file = open(output_file_name, "w")) try: run = RunObject.from_cwl_definition(run_id, inputs) run.ready() @@ -125,6 +129,11 @@ def submit_job(run_id, output_directory=None): inputs = dict() for port in run.port_set.filter(port_type=PortType.INPUT).all(): inputs[port.name] = port.value + + if settings.DUMP_JSON: + output_file_name = "{}.job.inputs-cwl.json".format(run_id) + print(json.dumps(inputs, indent = 4), file = open(output_file_name, "w")) + if not output_directory: output_directory = os.path.join(run.app.output_directory, str(run_id)) job = { @@ -132,6 +141,11 @@ def submit_job(run_id, output_directory=None): 'inputs': inputs, 'root_dir': output_directory } + + if settings.DUMP_JSON: + output_file_name = "{}.job.json".format(run_id) + print(json.dumps(job, indent = 4), file = open(output_file_name, "w")) + logger.info("Job %s ready for submitting" % run_id) response = requests.post(settings.RIDGEBACK_URL + '/v0/jobs/', json=job) if response.status_code == 201: From 8e43ac9395bbd562c702b5a88426a7d294ce7c79 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Thu, 27 Feb 2020 12:35:49 -0500 Subject: [PATCH 27/31] remove exception --- runner/operator/roslin_qc_operator/roslin_qc_operator.py | 3 --- 1 file changed, 3 deletions(-) diff --git a/runner/operator/roslin_qc_operator/roslin_qc_operator.py b/runner/operator/roslin_qc_operator/roslin_qc_operator.py index 32ee2fbf8..23649d2d7 100644 --- a/runner/operator/roslin_qc_operator/roslin_qc_operator.py +++ b/runner/operator/roslin_qc_operator/roslin_qc_operator.py @@ -4,9 +4,6 @@ from .bin import input import datetime -class InvalidPipelineError(Exception): - pass - class RoslinQcOperator(Operator): """ Operator for Roslin QC pipeline From 1f8643acb9140c2f74c5f878302971ccc009002b Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Thu, 27 Feb 2020 12:46:24 -0500 Subject: [PATCH 28/31] change filemetadata query method --- runner/operator/roslin_qc_operator/bin/input.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/runner/operator/roslin_qc_operator/bin/input.py b/runner/operator/roslin_qc_operator/bin/input.py index e50f4c44e..26ff745c9 100644 --- a/runner/operator/roslin_qc_operator/bin/input.py +++ b/runner/operator/roslin_qc_operator/bin/input.py @@ -138,7 +138,7 @@ def parse_pairs_from_ports(ports_queryset): files = port.files.all() for file in files: # get the highest 'version' number FileMetadata instance for the File - filemetata_instance = FileMetadata.objects.filter(file = file).order_by('-version').first() + filemetata_instance = file.filemetadata_set.first() R1_or_R2 = filemetata_instance.metadata['R'] tumor_or_normal = filemetata_instance.metadata['tumorOrNormal'] pair_items.append( {'filemetadata': filemetata_instance, 'R1_or_R2': R1_or_R2, 'tumor_or_normal': tumor_or_normal } ) @@ -160,7 +160,7 @@ def parse_pairs_from_ports(ports_queryset): elif item['tumor_or_normal'] == 'Normal' and item['R1_or_R2'] == 'R2': pair_set['normal']['R2'] = item['filemetadata'] pairs.append(pair_set) - return(pairs) + return pairs def parse_bams_from_ports(ports_queryset): """ From 0b68c26fc8e6f5ab67e355646a1ea5fdb9c5afa9 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Thu, 27 Feb 2020 13:55:50 -0500 Subject: [PATCH 29/31] add completion script --- scripts/complete-run-from-CWL-output.py | 36 +++++++++++++++++++++++++ 1 file changed, 36 insertions(+) create mode 100755 scripts/complete-run-from-CWL-output.py diff --git a/scripts/complete-run-from-CWL-output.py b/scripts/complete-run-from-CWL-output.py new file mode 100755 index 000000000..55ae73425 --- /dev/null +++ b/scripts/complete-run-from-CWL-output.py @@ -0,0 +1,36 @@ +#!/usr/bin/env python +# -*- coding: utf-8 -*- +""" +Script to mark a Beagle Run as "complete" using a pre-made JSON representing the CWL output +Use this by first creating a Run using; + + +curl -H "Content-Type: application/json" \ +-X POST \ +-H "Authorization: Bearer $$token" \ +--data '{"request_ids":["$(REQID)"], "pipeline_name": "$(PIPELINE)"}' \ +http://$(DJANGO_BEAGLE_IP):$(DJANGO_BEAGLE_PORT)/v0/run/request/ + +then, get the Run ID for the created Run (from Admin panel or other) and feed it the pre-made JSON output here to +populate all the Ports and Files for the run output +""" +import os +import sys +import django +import json + +# import django app from parent dir +parentdir = os.path.dirname(os.path.dirname(os.path.realpath(__file__))) +sys.path.insert(0, parentdir) +os.environ.setdefault("DJANGO_SETTINGS_MODULE", "beagle.settings") +django.setup() +from runner.run.objects.run_object import RunObject +sys.path.pop(0) + +run_id = sys.argv[1] +input_json = sys.argv[2] + +cwl_output = json.load(open(input_json)) +run_obj = RunObject.from_db(run_id = run_id) +run_obj.complete(outputs = cwl_output) +run_obj.to_db() From dd7070e77dc34a706a336dc252d4a0d5feccdb3b Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Tue, 3 Mar 2020 18:13:54 -0500 Subject: [PATCH 30/31] add dump all pipelines to script --- scripts/dump_db_fixtures.py | 20 +++++++++++++++----- 1 file changed, 15 insertions(+), 5 deletions(-) diff --git a/scripts/dump_db_fixtures.py b/scripts/dump_db_fixtures.py index 0884b9ccc..02cced8b0 100755 --- a/scripts/dump_db_fixtures.py +++ b/scripts/dump_db_fixtures.py @@ -174,13 +174,23 @@ def dump_pipeline(**kwargs): Dump re-loadable Django database fixtures for Pipeline entries and related table fixtures """ pipelineName = kwargs.pop('pipelineName') - output_pipeline_file = "{}.pipeline.json".format(pipelineName) - output_pipeline_filegroup_file = "{}.pipeline.output_file_group.json".format(pipelineName) + if pipelineName == "all": + output_pipeline_file = "all_pipeline.json".format(pipelineName) + output_pipeline_filegroup_file = "all_pipeline.output_file_group.json".format(pipelineName) - pipeline_instance = Pipeline.objects.get(name = pipelineName) - print(json.dumps(json.loads(serializers.serialize('json', [pipeline_instance])), indent=4), file = open(output_pipeline_file, "w")) + pipelines = Pipeline.objects.all() + print(json.dumps(json.loads(serializers.serialize('json', pipelines)), indent=4), file = open(output_pipeline_file, "w")) - print(json.dumps(json.loads(serializers.serialize('json', [pipeline_instance.output_file_group])), indent=4), file = open(output_pipeline_filegroup_file, "w")) + file_groups = FileGroup.objects.all() + print(json.dumps(json.loads(serializers.serialize('json', file_groups)), indent=4), file = open(output_pipeline_filegroup_file, "w")) + else: + output_pipeline_file = "{}.pipeline.json".format(pipelineName) + output_pipeline_filegroup_file = "{}.pipeline.output_file_group.json".format(pipelineName) + + pipeline_instance = Pipeline.objects.get(name = pipelineName) + print(json.dumps(json.loads(serializers.serialize('json', [pipeline_instance])), indent=4), file = open(output_pipeline_file, "w")) + + print(json.dumps(json.loads(serializers.serialize('json', [pipeline_instance.output_file_group])), indent=4), file = open(output_pipeline_filegroup_file, "w")) def get_files(value, type): """ From eb100ce65cfe268832631d9dda3a4604c256cc13 Mon Sep 17 00:00:00 2001 From: Stephen Kelly Date: Wed, 4 Mar 2020 17:46:12 -0500 Subject: [PATCH 31/31] refactor roslin qc operator to use updated roslin pipeline output --- beagle/settings.py | 1 + beagle_etl/fixtures/beagle_etl.operator.json | 2 +- .../fixtures/file_system.filegroup.json | 174 +- ...694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json | 6290 +++++++++++++++++ ...fc47b-3ee4-4867-890f-9bab87c7f53f.run.json | 6290 +++++++++++++++++ runner/fixtures/runner.pipeline.json | 72 +- .../operator/roslin_qc_operator/bin/input.py | 147 +- .../operator/roslin_qc_operator/test_input.py | 284 +- .../test_roslin_qc_operator.py | 9 +- scripts/dump_db_fixtures.py | 7 +- 10 files changed, 12910 insertions(+), 366 deletions(-) create mode 100644 fixtures/runs/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json create mode 100644 fixtures/runs/dfefc47b-3ee4-4867-890f-9bab87c7f53f.run.json diff --git a/beagle/settings.py b/beagle/settings.py index 9332cf083..917ba882c 100644 --- a/beagle/settings.py +++ b/beagle/settings.py @@ -316,4 +316,5 @@ PROJECT_DIR = os.path.dirname(os.path.realpath(__file__)) ROOT_DIR = os.path.dirname(PROJECT_DIR) TEST_FIXTURE_DIR = os.path.join(ROOT_DIR, "fixtures", "tests") +FIXTURES_DIR = os.path.join(ROOT_DIR, "fixtures") DUMP_JSON = os.environ.get('DUMP_JSON') == 'True' diff --git a/beagle_etl/fixtures/beagle_etl.operator.json b/beagle_etl/fixtures/beagle_etl.operator.json index 1c25080c7..4af0d3b2c 100644 --- a/beagle_etl/fixtures/beagle_etl.operator.json +++ b/beagle_etl/fixtures/beagle_etl.operator.json @@ -48,5 +48,5 @@ "class_name": "RoslinQcOperator", "slug": "roslin-qc" } - }, + } ] diff --git a/file_system/fixtures/file_system.filegroup.json b/file_system/fixtures/file_system.filegroup.json index fa4828340..7f6d71e67 100644 --- a/file_system/fixtures/file_system.filegroup.json +++ b/file_system/fixtures/file_system.filegroup.json @@ -1,90 +1,90 @@ [ -{ - "model": "file_system.filegroup", - "pk": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe", - "fields": { - "created_date": "2019-12-06T19:20:43.437Z", - "modified_date": "2019-12-06T19:20:43.437Z", - "name": "Origin Unknown", - "slug": "origin-unknown", - "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" + { + "model": "file_system.filegroup", + "pk": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe", + "fields": { + "created_date": "2019-12-06T19:20:43.437Z", + "modified_date": "2019-12-06T19:20:43.437Z", + "name": "Origin Unknown", + "slug": "origin-unknown", + "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" + } + }, + { + "model": "file_system.filegroup", + "pk": "0abb8733-dd3e-46d1-b147-def516f125f4", + "fields": { + "created_date": "2019-12-02T22:11:05.490Z", + "modified_date": "2019-12-02T22:11:05.490Z", + "name": "junk", + "slug": "junk", + "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" + } + }, + { + "model": "file_system.filegroup", + "pk": "1552617b-3b06-46de-921a-a000a9129385", + "fields": { + "created_date": "2020-01-22T19:19:05.790Z", + "modified_date": "2020-01-22T19:19:05.790Z", + "name": "Pooled Normal", + "slug": "pooled-normal", + "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" + } + }, + { + "model": "file_system.filegroup", + "pk": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a", + "fields": { + "created_date": "2019-10-01T20:52:31.890Z", + "modified_date": "2019-10-01T20:52:31.890Z", + "name": "LIMS", + "slug": "lims", + "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" + } + }, + { + "model": "file_system.filegroup", + "pk": "4616ef88-103c-4cf4-baab-f3a247bc2172", + "fields": { + "created_date": "2019-10-23T19:44:01.317Z", + "modified_date": "2019-10-23T19:44:01.317Z", + "name": "reference_files", + "slug": "reference_files", + "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" + } + }, + { + "model": "file_system.filegroup", + "pk": "a66f03b4-ce43-40d0-9134-d5a3575cabae", + "fields": { + "created_date": "2019-11-05T20:13:29.923Z", + "modified_date": "2019-11-05T20:13:29.923Z", + "name": "outputs", + "slug": "outputs", + "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" + } + }, + { + "model": "file_system.filegroup", + "pk": "a975f490-1b02-4575-abae-a4f8e3667733", + "fields": { + "created_date": "2019-11-18T17:44:56.345Z", + "modified_date": "2019-11-18T17:44:56.345Z", + "name": "roslin_pair_sv_outputs", + "slug": "roslin_pair_sv_outputs", + "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" + } + }, + { + "model": "file_system.filegroup", + "pk": "d9015037-cd6b-4cb6-87a8-16d355482461", + "fields": { + "created_date": "2019-11-19T20:02:12.221Z", + "modified_date": "2019-11-19T20:02:12.221Z", + "name": "access_m1_output", + "slug": "access_m1_output", + "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" + } } -}, -{ - "model": "file_system.filegroup", - "pk": "0abb8733-dd3e-46d1-b147-def516f125f4", - "fields": { - "created_date": "2019-12-02T22:11:05.490Z", - "modified_date": "2019-12-02T22:11:05.490Z", - "name": "junk", - "slug": "junk", - "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" - } -}, -{ - "model": "file_system.filegroup", - "pk": "1552617b-3b06-46de-921a-a000a9129385", - "fields": { - "created_date": "2020-01-22T19:19:05.790Z", - "modified_date": "2020-01-22T19:19:05.790Z", - "name": "Pooled Normal", - "slug": "pooled-normal", - "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" - } -}, -{ - "model": "file_system.filegroup", - "pk": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a", - "fields": { - "created_date": "2019-10-01T20:52:31.890Z", - "modified_date": "2019-10-01T20:52:31.890Z", - "name": "LIMS", - "slug": "lims", - "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" - } -}, -{ - "model": "file_system.filegroup", - "pk": "4616ef88-103c-4cf4-baab-f3a247bc2172", - "fields": { - "created_date": "2019-10-23T19:44:01.317Z", - "modified_date": "2019-10-23T19:44:01.317Z", - "name": "reference_files", - "slug": "reference_files", - "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" - } -}, -{ - "model": "file_system.filegroup", - "pk": "a66f03b4-ce43-40d0-9134-d5a3575cabae", - "fields": { - "created_date": "2019-11-05T20:13:29.923Z", - "modified_date": "2019-11-05T20:13:29.923Z", - "name": "outputs", - "slug": "outputs", - "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" - } -}, -{ - "model": "file_system.filegroup", - "pk": "a975f490-1b02-4575-abae-a4f8e3667733", - "fields": { - "created_date": "2019-11-18T17:44:56.345Z", - "modified_date": "2019-11-18T17:44:56.345Z", - "name": "roslin_pair_sv_outputs", - "slug": "roslin_pair_sv_outputs", - "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" - } -}, -{ - "model": "file_system.filegroup", - "pk": "d9015037-cd6b-4cb6-87a8-16d355482461", - "fields": { - "created_date": "2019-11-19T20:02:12.221Z", - "modified_date": "2019-11-19T20:02:12.221Z", - "name": "access_m1_output", - "slug": "access_m1_output", - "storage": "0cd14133-0f6a-413d-a498-495bf48546c0" - } -} ] diff --git a/fixtures/runs/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json b/fixtures/runs/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json new file mode 100644 index 000000000..d77409d95 --- /dev/null +++ b/fixtures/runs/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json @@ -0,0 +1,6290 @@ +[ + { + "model": "runner.run", + "pk": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "fields": { + "created_date": "2020-03-03T15:51:28.999Z", + "modified_date": "2020-03-03T16:36:07.390Z", + "name": "ROSLIN ALN-REQ-ID, 1 of 1 (03/03/2020, 15:51:28)", + "app": "c7849f2b-9a4f-4352-acde-1d993af379d8", + "status": 4, + "execution_id": "46b17469-330b-4fbf-a83a-da72e1dc09db", + "job_statuses": {}, + "output_metadata": {}, + "tags": { + "requestId": "ALN-REQ-ID", + "labHeadName": "", + "labHeadEmail": "", + "sampleNameTumor": "s_C_ALLANT_T001_d", + "sampleNameNormal": "s_C_ALLANT_N002_d" + } + } + }, + { + "model": "runner.port", + "pk": "0de3037b-f83a-4333-919c-d491eaefeb38", + "fields": { + "created_date": "2020-03-03T15:51:33.058Z", + "modified_date": "2020-03-03T16:36:07.037Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "db_files", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "refseq": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "vep_data": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "vep_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "custom_enst": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_snps": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_vcf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "fp_genotypes": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "fp_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_list": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "bait_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "hotspot_list_maf": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "target_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers_bed": { + "type": [ + "null", + "array" + ], + "items": "string" + } + } + }, + "secondary_files": [], + "db_value": { + "refseq": { + "class": "File", + "location": "bid://3814d1da-e507-4e7d-b65b-b4ae7e07ec61" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "class": "File", + "location": "bid://584079c8-13af-4816-9ad3-50ce86e13934" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "class": "File", + "location": "bid://3f2fcb1e-cdf4-4d71-8369-04197b5ef7ff" + }, + "fp_intervals": { + "class": "File", + "location": "bid://d058dd8e-6097-4556-b7e7-7c2184789036" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "class": "File", + "location": "bid://e0e6283e-24ba-466f-9ec6-b6d9d85b2acd" + }, + "bait_intervals": { + "class": "File", + "location": "bid://14b45ffc-8797-40dd-b456-669bf79c22bb" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "class": "File", + "location": "bid://92bff766-15fd-4316-8977-77afcef97dae" + }, + "target_intervals": { + "class": "File", + "location": "bid://dce51627-5764-429b-ba52-f9cab17d967d" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "value": { + "refseq": { + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.txt", + "class": "File" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "class": "File" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/FP_tiling_genotypes.txt", + "class": "File" + }, + "fp_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/FP_tiling_intervals.list", + "class": "File" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.tsv", + "class": "File" + }, + "bait_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/picard_baits.interval_list", + "class": "File" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf", + "class": "File" + }, + "target_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/picard_targets.interval_list", + "class": "File" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "files": [ + "14b45ffc-8797-40dd-b456-669bf79c22bb", + "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "3f2fcb1e-cdf4-4d71-8369-04197b5ef7ff", + "584079c8-13af-4816-9ad3-50ce86e13934", + "92bff766-15fd-4316-8977-77afcef97dae", + "d058dd8e-6097-4556-b7e7-7c2184789036", + "dce51627-5764-429b-ba52-f9cab17d967d", + "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd" + ] + } + }, + { + "model": "runner.port", + "pk": "f5cc5ee0-f351-4bf3-ae79-d1ab719ee44f", + "fields": { + "created_date": "2020-03-03T15:51:33.075Z", + "modified_date": "2020-03-03T16:36:07.040Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "ref_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://96e3a791-2bc7-45f8-acc6-e519a29d5d0b" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta", + "class": "File" + }, + "files": [ + "96e3a791-2bc7-45f8-acc6-e519a29d5d0b" + ] + } + }, + { + "model": "runner.port", + "pk": "25952c45-f647-4d2f-a845-fb49acc8e0cf", + "fields": { + "created_date": "2020-03-03T15:51:33.082Z", + "modified_date": "2020-03-03T16:36:07.043Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "mouse_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://b6b418fe-6c83-43a2-8bdc-f3af2b0954a7" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta", + "class": "File" + }, + "files": [ + "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7" + ] + } + }, + { + "model": "runner.port", + "pk": "309490d3-84a2-4d2b-9a59-5257d46146b9", + "fields": { + "created_date": "2020-03-03T15:51:33.088Z", + "modified_date": "2020-03-03T16:36:07.046Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "hapmap", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://87b6a57c-f15b-49eb-9d22-d3893d2e00ef" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf", + "class": "File" + }, + "files": [ + "87b6a57c-f15b-49eb-9d22-d3893d2e00ef" + ] + } + }, + { + "model": "runner.port", + "pk": "07ed257f-1346-4ca4-bb13-6a3f3cfdccf1", + "fields": { + "created_date": "2020-03-03T15:51:33.094Z", + "modified_date": "2020-03-03T16:36:07.050Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "dbsnp", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://914dce04-bc41-427e-9b6c-3084bfa61250" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf", + "class": "File" + }, + "files": [ + "914dce04-bc41-427e-9b6c-3084bfa61250" + ] + } + }, + { + "model": "runner.port", + "pk": "433c869d-5316-47cd-9df9-e1be27643e1d", + "fields": { + "created_date": "2020-03-03T15:51:33.100Z", + "modified_date": "2020-03-03T16:36:07.053Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "indels_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://c868b6e9-92bd-4855-9726-7945e4471973" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf", + "class": "File" + }, + "files": [ + "c868b6e9-92bd-4855-9726-7945e4471973" + ] + } + }, + { + "model": "runner.port", + "pk": "3a841dcc-efb8-4cf3-84a2-7543b9e2c4f7", + "fields": { + "created_date": "2020-03-03T15:51:33.106Z", + "modified_date": "2020-03-03T16:36:07.057Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "snps_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://6f644f7f-a7b7-4573-a40a-6c5838f58b75" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf", + "class": "File" + }, + "files": [ + "6f644f7f-a7b7-4573-a40a-6c5838f58b75" + ] + } + }, + { + "model": "runner.port", + "pk": "f1a4fb81-4f32-4155-a8e6-2e664e42d486", + "fields": { + "created_date": "2020-03-03T15:51:33.112Z", + "modified_date": "2020-03-03T16:36:07.060Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "cosmic", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://100204c9-c560-43d9-ab4d-8c03bc207f4e" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "class": "File" + }, + "files": [ + "100204c9-c560-43d9-ab4d-8c03bc207f4e" + ] + } + }, + { + "model": "runner.port", + "pk": "34c5d051-9ff9-45a0-8b62-afe442c4fc15", + "fields": { + "created_date": "2020-03-03T15:51:33.119Z", + "modified_date": "2020-03-03T16:36:07.063Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "exac_filter", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "class": "File", + "location": "bid://5c1dfb8e-d831-43f1-892b-f3c0bf043ca2" + }, + "value": { + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "class": "File" + }, + "files": [ + "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2" + ] + } + }, + { + "model": "runner.port", + "pk": "74cc9f01-469a-4ccc-902a-5a52a85933e7", + "fields": { + "created_date": "2020-03-03T15:51:33.155Z", + "modified_date": "2020-03-03T16:36:07.096Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "runparams", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "pi": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "assay": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "genome": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "tmp_dir": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "pi_email": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "intervals": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "mutect_rf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "complex_nn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "complex_tn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "covariates": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_type": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_cval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "mutect_dcov": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "num_threads": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "abra_ram_min": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "abra_scratch": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_pcval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "gatk_jar_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "project_prefix": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "opt_dup_pix_dist": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "emit_original_quals": { + "type": [ + "null", + "array" + ], + "items": "boolean" + }, + "num_cpu_threads_per_data_thread": { + "type": [ + "null", + "array" + ], + "items": "int" + } + } + }, + "secondary_files": [], + "db_value": { + "pi": "", + "assay": "IMPACT468_BAITS", + "genome": "GRCh37", + "tmp_dir": "/var/folders/0l/g_nl9gp57r57h3jvs9pznc9c2dx_pd/T/", + "pi_email": "", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.2, + "complex_tn": 0.5, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 50, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/var/folders/0l/g_nl9gp57r57h3jvs9pznc9c2dx_pd/T/", + "facets_pcval": 100, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": "ALN-REQ-ID", + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "value": { + "pi": "", + "assay": "IMPACT468_BAITS", + "genome": "GRCh37", + "tmp_dir": "/var/folders/0l/g_nl9gp57r57h3jvs9pznc9c2dx_pd/T/", + "pi_email": "", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.2, + "complex_tn": 0.5, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 50, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/var/folders/0l/g_nl9gp57r57h3jvs9pznc9c2dx_pd/T/", + "facets_pcval": 100, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": "ALN-REQ-ID", + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "files": [] + } + }, + { + "model": "runner.port", + "pk": "d202001f-ccf7-4e4e-87ab-1e978fc146a9", + "fields": { + "created_date": "2020-03-03T15:51:33.158Z", + "modified_date": "2020-03-03T16:36:07.102Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "pair", + "port_type": 0, + "schema": { + "type": "array", + "items": "record" + }, + "secondary_files": [], + "db_value": [ + { + "CN": "MSKCC", + "ID": "s_C_ALLANT_T001_d", + "LB": "MyLibraryId", + "PL": "Illumina", + "PU": [ + "MyFlowCellId_MyBarcodeIndex" + ], + "R1": [ + { + "class": "File", + "location": "bid://450fc99c-c84f-4b4e-9a32-1e6ca6341cad" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://0edc3e64-6cfc-4f15-a3cb-6f90fdf01d15" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_ALLANT_T001_d_MyFlowCellId_MyBarcodeIndex" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_ALLANT_T001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_ALLANT_N002_d", + "LB": "MyLibraryId", + "PL": "Illumina", + "PU": [ + "MyFlowCellId_MyBarcodeIndex" + ], + "R1": [ + { + "class": "File", + "location": "bid://04f44221-a5d5-4b4c-84d4-92c8c8a4da5a" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://b02c07f0-326a-44b4-9980-62954027f342" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_ALLANT_N002_d_MyFlowCellId_MyBarcodeIndex" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_ALLANT_N002_d.bam" + } + ], + "value": [ + { + "CN": "MSKCC", + "ID": "s_C_ALLANT_T001_d", + "LB": "MyLibraryId", + "PL": "Illumina", + "PU": [ + "MyFlowCellId_MyBarcodeIndex" + ], + "R1": [ + { + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz", + "class": "File" + } + ], + "R2": [ + { + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz", + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_ALLANT_T001_d_MyFlowCellId_MyBarcodeIndex" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_ALLANT_T001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_ALLANT_N002_d", + "LB": "MyLibraryId", + "PL": "Illumina", + "PU": [ + "MyFlowCellId_MyBarcodeIndex" + ], + "R1": [ + { + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz", + "class": "File" + } + ], + "R2": [ + { + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz", + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_ALLANT_N002_d_MyFlowCellId_MyBarcodeIndex" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_ALLANT_N002_d.bam" + } + ], + "files": [ + "04f44221-a5d5-4b4c-84d4-92c8c8a4da5a", + "0edc3e64-6cfc-4f15-a3cb-6f90fdf01d15", + "450fc99c-c84f-4b4e-9a32-1e6ca6341cad", + "b02c07f0-326a-44b4-9980-62954027f342" + ] + } + }, + { + "model": "runner.port", + "pk": "a42d340f-8a88-4bb9-88f4-1fd2816955d7", + "fields": { + "created_date": "2020-03-03T15:51:33.125Z", + "modified_date": "2020-03-03T16:36:07.092Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "curated_bams", + "port_type": 0, + "schema": { + "type": "array", + "items": [ + "null", + "array" + ] + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "class": "File", + "location": "bid://4af32904-03d2-4646-822d-8e520239421f" + }, + { + "class": "File", + "location": "bid://eaec3382-528f-4b6b-acff-b718c84a8980" + }, + { + "class": "File", + "location": "bid://e800d375-bd52-4829-9d37-18194d0e8824" + }, + { + "class": "File", + "location": "bid://f085a161-0f9e-4e7d-bef4-dce17f3cf311" + }, + { + "class": "File", + "location": "bid://9956c92d-395c-49bd-8806-93e94d66f91c" + }, + { + "class": "File", + "location": "bid://a4e02e9e-833e-4dfc-a8d8-caece136a2af" + }, + { + "class": "File", + "location": "bid://b6ae85ba-fd31-475a-b0fe-2a32789a4692" + }, + { + "class": "File", + "location": "bid://f4aeecab-b064-4935-a2af-014e633d5ef2" + }, + { + "class": "File", + "location": "bid://13b6946e-c047-49b8-bac3-34efddb0847d" + }, + { + "class": "File", + "location": "bid://7e7c92fd-1653-4de5-b0ad-fb1b35eafd95" + }, + { + "class": "File", + "location": "bid://7c918d29-514c-447b-81ee-8c7c36ee098c" + }, + { + "class": "File", + "location": "bid://312220bd-8bb6-41bd-817f-59217c364fdf" + }, + { + "class": "File", + "location": "bid://be0ed0ea-33f6-4331-9af9-6439f7b149d0" + }, + { + "class": "File", + "location": "bid://d959d541-f891-441d-9951-a6d1df49fb91" + }, + { + "class": "File", + "location": "bid://b75b9ba0-022c-4ec1-87f3-8c81d8b5d88b" + }, + { + "class": "File", + "location": "bid://acccd858-813d-46c3-85da-d7063f051f89" + }, + { + "class": "File", + "location": "bid://7a71c994-7c88-4523-8abd-ae50d792ba19" + }, + { + "class": "File", + "location": "bid://63fcfa9f-b2b1-446b-b1e5-0f58803fb2f4" + }, + { + "class": "File", + "location": "bid://54b4aef7-46f3-417b-949c-7d44d94b69df" + }, + { + "class": "File", + "location": "bid://d78b21a5-d156-4d96-b532-d7788872f292" + }, + { + "class": "File", + "location": "bid://8d2afc5f-7fc2-4584-a169-bd978314ae43" + }, + { + "class": "File", + "location": "bid://b4f708ff-8bea-47fc-8a4e-3ced60b817b1" + }, + { + "class": "File", + "location": "bid://fd08b546-720f-4622-b79d-693936d2b608" + }, + { + "class": "File", + "location": "bid://84c1c4a4-8ad9-4df8-a30d-fd5d9ec58cc7" + }, + { + "class": "File", + "location": "bid://938e0e74-bd4a-4d3f-b9e3-c327acad3f44" + }, + { + "class": "File", + "location": "bid://8e9b5b36-da56-4dc8-a895-0ff14a5457bc" + }, + { + "class": "File", + "location": "bid://c0298d8e-2dcf-487b-a1c5-888522a55abc" + }, + { + "class": "File", + "location": "bid://8a8dd9e3-1970-41d9-abfe-8d5f62745cbf" + }, + { + "class": "File", + "location": "bid://768c19d8-a4e6-4c14-86d9-8ac6fcd51798" + }, + { + "class": "File", + "location": "bid://87663bfc-8a6f-4c30-9528-85c4c9859abe" + }, + { + "class": "File", + "location": "bid://e339ee8d-4e73-4ca5-907a-eb8296c1cd18" + }, + { + "class": "File", + "location": "bid://ebbb6238-0bdb-4e28-9040-9e257ffb3407" + }, + { + "class": "File", + "location": "bid://0d184175-1f65-4af0-b67d-c93c7d50988a" + }, + { + "class": "File", + "location": "bid://29f16470-1721-4957-9fa4-c42a685e65e9" + }, + { + "class": "File", + "location": "bid://f70c128b-3466-4399-99d9-4bf33a5a53fe" + }, + { + "class": "File", + "location": "bid://62366951-1c94-4b75-82c6-384d5359cebe" + }, + { + "class": "File", + "location": "bid://c033a8df-2197-4e99-95ba-b47e5659621c" + }, + { + "class": "File", + "location": "bid://baa2b1ea-6954-4d48-87f6-017a1786b4eb" + }, + { + "class": "File", + "location": "bid://fee5555e-ca62-4213-ae2f-a86e45f1ab02" + }, + { + "class": "File", + "location": "bid://31f3fa2b-face-431d-ac31-5e4aa5c1f534" + } + ], + "value": [ + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006708_N001_d.Group9.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006709_N001_d.Group11.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006710_N001_d.Group5.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006711_N001_d.Group7.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006713_N001_d.Group10.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006714_N001_d.Group8.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006715_N001_d.Group6.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006716_N001_d.Group4.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006717_N001_d.Group3.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006718_N001_d.Group1.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_09TAFV_N001_d.Group20.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_1FPU8J_N001_d.Group10.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_29F7HE_N001_d.Group17.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_2J273K_N001_d.Group22.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_32WX55_N001_d.Group17.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_3WFCFP_N001_d.Group24.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_4XFY8V_N001_d.Group2.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_7XDAJW_N001_d.Group15.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_96X4FW_N001_d.Group13.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_A8N9WX_N001_d.Group12.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_CTR0E9_N001_d.Group25.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_DJE4C0_N001_d.Group8.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FDR1YC_N001_d.Group27.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FWK8C0_N001_d.Group8.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_HRE3UJ_N001_d.Group9.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JFM1K9_N001_d.Group3.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JWYL4J_N001_d.Group19.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_KAT85C_N001_d.Group15.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LC80PX_N001_d.Group7.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LNNV52_N001_d.Group26.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_MWF8PH_N001_d.Group6.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NJHH88_N001_d.Group16.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NR3W32_N001_d.Group21.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_P10A8A_N001_d.Group29.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U53DXH_N001_d.Group1.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U8A7CR_N001_d.Group14.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_VXC8TK_N001_d.Group24.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_W0TXP0_N001_d.Group22.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_WWTK32_N001_d.Group18.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_XXC7N6_N001_d.Group12.rg.md.abra.printreads.bam", + "class": "File" + } + ], + "files": [ + "0d184175-1f65-4af0-b67d-c93c7d50988a", + "13b6946e-c047-49b8-bac3-34efddb0847d", + "29f16470-1721-4957-9fa4-c42a685e65e9", + "312220bd-8bb6-41bd-817f-59217c364fdf", + "31f3fa2b-face-431d-ac31-5e4aa5c1f534", + "4af32904-03d2-4646-822d-8e520239421f", + "54b4aef7-46f3-417b-949c-7d44d94b69df", + "62366951-1c94-4b75-82c6-384d5359cebe", + "63fcfa9f-b2b1-446b-b1e5-0f58803fb2f4", + "768c19d8-a4e6-4c14-86d9-8ac6fcd51798", + "7a71c994-7c88-4523-8abd-ae50d792ba19", + "7c918d29-514c-447b-81ee-8c7c36ee098c", + "7e7c92fd-1653-4de5-b0ad-fb1b35eafd95", + "84c1c4a4-8ad9-4df8-a30d-fd5d9ec58cc7", + "87663bfc-8a6f-4c30-9528-85c4c9859abe", + "8a8dd9e3-1970-41d9-abfe-8d5f62745cbf", + "8d2afc5f-7fc2-4584-a169-bd978314ae43", + "8e9b5b36-da56-4dc8-a895-0ff14a5457bc", + "938e0e74-bd4a-4d3f-b9e3-c327acad3f44", + "9956c92d-395c-49bd-8806-93e94d66f91c", + "a4e02e9e-833e-4dfc-a8d8-caece136a2af", + "acccd858-813d-46c3-85da-d7063f051f89", + "b4f708ff-8bea-47fc-8a4e-3ced60b817b1", + "b6ae85ba-fd31-475a-b0fe-2a32789a4692", + "b75b9ba0-022c-4ec1-87f3-8c81d8b5d88b", + "baa2b1ea-6954-4d48-87f6-017a1786b4eb", + "be0ed0ea-33f6-4331-9af9-6439f7b149d0", + "c0298d8e-2dcf-487b-a1c5-888522a55abc", + "c033a8df-2197-4e99-95ba-b47e5659621c", + "d78b21a5-d156-4d96-b532-d7788872f292", + "d959d541-f891-441d-9951-a6d1df49fb91", + "e339ee8d-4e73-4ca5-907a-eb8296c1cd18", + "e800d375-bd52-4829-9d37-18194d0e8824", + "eaec3382-528f-4b6b-acff-b718c84a8980", + "ebbb6238-0bdb-4e28-9040-9e257ffb3407", + "f085a161-0f9e-4e7d-bef4-dce17f3cf311", + "f4aeecab-b064-4935-a2af-014e633d5ef2", + "f70c128b-3466-4399-99d9-4bf33a5a53fe", + "fd08b546-720f-4622-b79d-693936d2b608", + "fee5555e-ca62-4213-ae2f-a86e45f1ab02" + ] + } + }, + { + "model": "runner.port", + "pk": "ffae4caf-c40f-4230-b4bc-19ff36b8aede", + "fields": { + "created_date": "2020-03-03T15:51:33.184Z", + "modified_date": "2020-03-03T16:36:07.164Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "hs_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 4415, + "class": "File", + "location": "bid://da37fe31-85ff-40e1-93a6-c279a6a54d7d" + }, + { + "size": 4373, + "class": "File", + "location": "bid://d1e657e2-1342-4106-9ea3-8fea5da81a3e" + } + ], + "value": [ + { + "size": 4415, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.hsmetrics", + "checksum": "sha1$d6e25b6b811af190c466963249c400a3accf92d5", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.hsmetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 4373, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.hsmetrics", + "checksum": "sha1$3cdf3f8cff6675537e54820f5641526bd31a4c96", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.hsmetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "d1e657e2-1342-4106-9ea3-8fea5da81a3e", + "da37fe31-85ff-40e1-93a6-c279a6a54d7d" + ] + } + }, + { + "model": "runner.port", + "pk": "0163a471-0976-4c87-ba9f-fc5d56527964", + "fields": { + "created_date": "2020-03-03T15:51:33.211Z", + "modified_date": "2020-03-03T16:36:07.225Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "gcbias_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6768, + "class": "File", + "location": "bid://634bc305-0109-42f3-ae73-7cb38c7b816d" + }, + { + "size": 6811, + "class": "File", + "location": "bid://333f2ff8-c1d1-4464-afd1-002ee6c26410" + } + ], + "value": [ + { + "size": 6768, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_T001_d.rg.md.gcbias.pdf", + "checksum": "sha1$feaf8e4cde516b2267465ad780b5e186079fa375", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.gcbias" + }, + { + "size": 6811, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_N002_d.rg.md.gcbias.pdf", + "checksum": "sha1$561510141a950f6633faba9da287bae0fc602ae9", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.gcbias.pdf", + "nameroot": "s_C_ALLANT_N002_d.rg.md.gcbias" + } + ], + "files": [ + "333f2ff8-c1d1-4464-afd1-002ee6c26410", + "634bc305-0109-42f3-ae73-7cb38c7b816d" + ] + } + }, + { + "model": "runner.port", + "pk": "ee28625e-17db-4f1b-b0f9-230a5d7bf999", + "fields": { + "created_date": "2020-03-03T15:51:33.228Z", + "modified_date": "2020-03-03T16:36:07.256Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "mutect_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 33881, + "class": "File", + "location": "bid://da766256-deac-48be-97ae-cf5691abbe21" + }, + "value": { + "size": 33881, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$2d00d8016b5e8dca7d3b98edef153f18d58453b3", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.vcf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "da766256-deac-48be-97ae-cf5691abbe21" + ] + } + }, + { + "model": "runner.port", + "pk": "ab74d166-d228-40b1-bd40-3c7112e7d352", + "fields": { + "created_date": "2020-03-03T15:51:33.236Z", + "modified_date": "2020-03-03T16:36:07.270Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "vardict_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 405145, + "class": "File", + "location": "bid://e009f03e-0db8-4432-979e-50c3faa1ffee" + }, + "value": { + "size": 405145, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$fbab450a0662d8575a0e15cf6c1d0aea61755815", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.vcf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict" + }, + "files": [ + "e009f03e-0db8-4432-979e-50c3faa1ffee" + ] + } + }, + { + "model": "runner.port", + "pk": "e71b44fc-2177-4b02-9092-5faa417691d6", + "fields": { + "created_date": "2020-03-03T15:51:33.260Z", + "modified_date": "2020-03-03T16:36:07.320Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "facets_txt_hisens", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 568, + "class": "File", + "location": "bid://4020cdc5-3d7e-4ce6-9aad-31f48b65a79a" + }, + "value": { + "size": 568, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$1bc524c02bda27693e5528e2eb1f70e3c28b1cc7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf.txt", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf" + }, + "files": [ + "4020cdc5-3d7e-4ce6-9aad-31f48b65a79a" + ] + } + }, + { + "model": "runner.port", + "pk": "1fe4e186-72ca-4822-a6df-ca56e4582f67", + "fields": { + "created_date": "2020-03-03T15:51:33.278Z", + "modified_date": "2020-03-03T16:36:07.363Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "facets_counts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 80583, + "class": "File", + "location": "bid://a4e6e929-352b-4846-a269-d54087920426" + }, + "value": { + "size": 80583, + "class": "File", + "nameext": ".gz", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$d0cbda7de6d84ce4c96dd2e8953c3840c4e40489", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat.gz", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat" + }, + "files": [ + "a4e6e929-352b-4846-a269-d54087920426" + ] + } + }, + { + "model": "runner.port", + "pk": "bce9b19d-1cfb-4b19-9968-6a74b74cf4af", + "fields": { + "created_date": "2020-03-03T15:51:33.285Z", + "modified_date": "2020-03-03T16:36:07.371Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "genome", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "GRCh37", + "value": "GRCh37", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "2a235272-7969-44c8-95a2-912c3e766c22", + "fields": { + "created_date": "2020-03-03T15:51:33.289Z", + "modified_date": "2020-03-03T16:36:07.374Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "assay", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "IMPACT468_BAITS", + "value": "IMPACT468_BAITS", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "be4f76e9-82ac-44df-9249-ebf784bae932", + "fields": { + "created_date": "2020-03-03T15:51:33.293Z", + "modified_date": "2020-03-03T16:36:07.377Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "pi", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "", + "value": "", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "7feb1cdc-4f07-46d4-9253-c582f5488455", + "fields": { + "created_date": "2020-03-03T15:51:33.297Z", + "modified_date": "2020-03-03T16:36:07.379Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "project_prefix", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "ALN-REQ-ID", + "value": "ALN-REQ-ID", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "ae90d08d-943b-4937-a76d-8ec86cdc9ead", + "fields": { + "created_date": "2020-03-03T15:51:33.301Z", + "modified_date": "2020-03-03T16:36:07.382Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "pi_email", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "", + "value": "", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "5579abc3-430c-4339-8fcf-85feb6588cc2", + "fields": { + "created_date": "2020-03-03T15:51:33.305Z", + "modified_date": "2020-03-03T16:36:07.385Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "normal_sample_name", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "s_C_ALLANT_N002_d", + "value": "s_C_ALLANT_N002_d", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "2aa943dc-cf2c-4f0c-be15-2a6c2319531f", + "fields": { + "created_date": "2020-03-03T15:51:33.309Z", + "modified_date": "2020-03-03T16:36:07.387Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "tumor_sample_name", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "s_C_ALLANT_T001_d", + "value": "s_C_ALLANT_T001_d", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "94007148-0e26-4a53-9fc6-05a8f681f814", + "fields": { + "created_date": "2020-03-03T15:51:33.165Z", + "modified_date": "2020-03-03T16:36:07.110Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "normal_bam", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + "^.bai" + ], + "db_value": { + "size": 37592874, + "class": "File", + "location": "bid://1c476759-813b-4347-aa9f-fa9682c2a944", + "secondaryFiles": [ + { + "size": 995248, + "class": "File", + "location": "bid://99db2f04-d515-4b56-958d-a94156a3c0b0" + } + ] + }, + "value": { + "size": 37592874, + "class": "File", + "nameext": ".bam", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads.bam", + "checksum": "sha1$d727a163467119433d91a16b9f5c79620560d361", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 995248, + "class": "File", + "nameext": ".bai", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads.bai", + "checksum": "sha1$c79ba39193d16034520bb06e304716cbe043f0a7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads" + } + ] + }, + "files": [ + "1c476759-813b-4347-aa9f-fa9682c2a944", + "99db2f04-d515-4b56-958d-a94156a3c0b0" + ] + } + }, + { + "model": "runner.port", + "pk": "edc0eb09-c176-412f-9362-6d9d04579701", + "fields": { + "created_date": "2020-03-03T15:51:33.169Z", + "modified_date": "2020-03-03T16:36:07.120Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "tumor_bam", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + "^.bai" + ], + "db_value": { + "size": 36055523, + "class": "File", + "location": "bid://4e7dabb9-d7e6-42d8-9465-38a458a569c3", + "secondaryFiles": [ + { + "size": 1526040, + "class": "File", + "location": "bid://53bae2b3-a71e-4224-9d7b-fa291d316192" + } + ] + }, + "value": { + "size": 36055523, + "class": "File", + "nameext": ".bam", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$b13b3c87e3b118f17f53f4ba453fa8656c2c944b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 1526040, + "class": "File", + "nameext": ".bai", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$c806324c7088f036f57fa805941d8651ec36441e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads" + } + ] + }, + "files": [ + "4e7dabb9-d7e6-42d8-9465-38a458a569c3", + "53bae2b3-a71e-4224-9d7b-fa291d316192" + ] + } + }, + { + "model": "runner.port", + "pk": "97eaa7f1-1514-4a9a-9ffc-077de6312ed2", + "fields": { + "created_date": "2020-03-03T15:51:33.172Z", + "modified_date": "2020-03-03T16:36:07.128Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "clstats1", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 1965, + "class": "File", + "location": "bid://41d65651-7e58-4f87-9690-f1efe8925d3b" + } + ], + [ + { + "size": 1956, + "class": "File" + } + ] + ], + "value": [ + [ + { + "size": 1965, + "class": "File", + "nameext": ".stats", + "basename": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "checksum": "sha1$61e0cec0218201210c080d6eef6b1392c65f4234", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "nameroot": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl" + } + ], + [ + { + "size": 1956, + "class": "File", + "nameext": ".stats", + "basename": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "checksum": "sha1$bd1e1f36e33069e06b5146c3d2d633bcb6f25c16", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "nameroot": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl" + } + ] + ], + "files": [ + "41d65651-7e58-4f87-9690-f1efe8925d3b" + ] + } + }, + { + "model": "runner.port", + "pk": "5470f605-df1e-40f9-b403-fe84341fcc35", + "fields": { + "created_date": "2020-03-03T15:51:33.175Z", + "modified_date": "2020-03-03T16:36:07.136Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "clstats2", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2170, + "class": "File", + "location": "bid://22564e78-f3e1-4434-a048-b743624567ff" + } + ], + [ + { + "size": 2126, + "class": "File" + } + ] + ], + "value": [ + [ + { + "size": 2170, + "class": "File", + "nameext": ".stats", + "basename": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "checksum": "sha1$f4e4a679ee31847c9d3840e80a5f6a4dafa25f93", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "nameroot": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl" + } + ], + [ + { + "size": 2126, + "class": "File", + "nameext": ".stats", + "basename": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "checksum": "sha1$89d50a84a5b8855c7970b91ba64ac8584d52dcee", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "nameroot": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl" + } + ] + ], + "files": [ + "22564e78-f3e1-4434-a048-b743624567ff" + ] + } + }, + { + "model": "runner.port", + "pk": "10c11022-b384-4cd1-a8eb-2fc237b3057a", + "fields": { + "created_date": "2020-03-03T15:51:33.178Z", + "modified_date": "2020-03-03T16:36:07.146Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "md_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2761, + "class": "File", + "location": "bid://f0f3c04d-3773-4c1c-aa42-cddb3ed5d49f" + }, + { + "size": 2834, + "class": "File", + "location": "bid://0c0283e3-4407-4985-b44f-bcf28dab85ed" + } + ], + "value": [ + { + "size": 2761, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_ALLANT_T001_d.rg.md_metrics", + "checksum": "sha1$3a2b89dccafaf8c6dc88feb807abe69f4c347856", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md_metrics", + "nameroot": "s_C_ALLANT_T001_d.rg" + }, + { + "size": 2834, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_ALLANT_N002_d.rg.md_metrics", + "checksum": "sha1$ac16852e822bf399f1e27260d19ad2ad6fa9dd37", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md_metrics", + "nameroot": "s_C_ALLANT_N002_d.rg" + } + ], + "files": [ + "0c0283e3-4407-4985-b44f-bcf28dab85ed", + "f0f3c04d-3773-4c1c-aa42-cddb3ed5d49f" + ] + } + }, + { + "model": "runner.port", + "pk": "6f17aabf-e94e-483b-a19e-49927f6f46c3", + "fields": { + "created_date": "2020-03-03T15:51:33.181Z", + "modified_date": "2020-03-03T16:36:07.155Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "as_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2075, + "class": "File", + "location": "bid://fa8b9929-7533-45d6-81be-091ab96f1041" + }, + { + "size": 2081, + "class": "File", + "location": "bid://f47bb433-b945-4e81-982f-13e6dae5d3c1" + } + ], + "value": [ + { + "size": 2075, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.asmetrics", + "checksum": "sha1$9f627fcbee942e916106fa09f7a828261b0309a2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.asmetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 2081, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.asmetrics", + "checksum": "sha1$832871e4ebf70050a5a2bd48646706602c9f70b7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.asmetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "f47bb433-b945-4e81-982f-13e6dae5d3c1", + "fa8b9929-7533-45d6-81be-091ab96f1041" + ] + } + }, + { + "model": "runner.port", + "pk": "1c08c0a5-4297-49e2-8bf4-e4cf17cb36f5", + "fields": { + "created_date": "2020-03-03T15:51:33.187Z", + "modified_date": "2020-03-03T16:36:07.174Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "insert_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 3602, + "class": "File", + "location": "bid://e9aab203-3487-41fb-a957-6b014c971297" + }, + { + "size": 5243, + "class": "File", + "location": "bid://4b1aa141-7efd-4836-8d96-2639218c29c9" + } + ], + "value": [ + { + "size": 3602, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.ismetrics", + "checksum": "sha1$218d9d4807292d3550d589b965e3655a57547667", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.ismetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 5243, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.ismetrics", + "checksum": "sha1$365a77b5850eed21268ead732e68b616862d4e9a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.ismetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "4b1aa141-7efd-4836-8d96-2639218c29c9", + "e9aab203-3487-41fb-a957-6b014c971297" + ] + } + }, + { + "model": "runner.port", + "pk": "544ff944-afb3-494d-8175-d7e4d6414b8e", + "fields": { + "created_date": "2020-03-03T15:51:33.191Z", + "modified_date": "2020-03-03T16:36:07.184Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "insert_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 9432, + "class": "File", + "location": "bid://3df838af-02d4-4949-b582-5e114bfe224c" + }, + { + "size": 12553, + "class": "File", + "location": "bid://9a860e59-3a48-40e9-b87d-9ac6bcc24463" + } + ], + "value": [ + { + "size": 9432, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_T001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$7595c14b4130fa3d1752fca924230658ad503c50", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.ismetrics" + }, + { + "size": 12553, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_N002_d.rg.md.ismetrics.pdf", + "checksum": "sha1$52bdfd03e647923336a246ba77061ed30e719868", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_ALLANT_N002_d.rg.md.ismetrics" + } + ], + "files": [ + "3df838af-02d4-4949-b582-5e114bfe224c", + "9a860e59-3a48-40e9-b87d-9ac6bcc24463" + ] + } + }, + { + "model": "runner.port", + "pk": "c2c96c04-48e1-4c37-ad0c-acff0dbe2634", + "fields": { + "created_date": "2020-03-03T15:51:33.195Z", + "modified_date": "2020-03-03T16:36:07.192Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "per_target_coverage", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 380579, + "class": "File", + "location": "bid://7baa520c-4d32-4be2-8af8-52b82e00ac9c" + }, + { + "size": 381117, + "class": "File", + "location": "bid://a5bae30f-0cf4-4fff-9ca3-fce7f21aafe8" + } + ], + "value": [ + { + "size": 380579, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.hstmetrics", + "checksum": "sha1$cb9ebd2583e8196e59f921275a9528e072f7f02a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.hstmetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 381117, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.hstmetrics", + "checksum": "sha1$60711c1d8999762cb51d261a77b94b1b788268a8", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.hstmetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "7baa520c-4d32-4be2-8af8-52b82e00ac9c", + "a5bae30f-0cf4-4fff-9ca3-fce7f21aafe8" + ] + } + }, + { + "model": "runner.port", + "pk": "ddaa826d-ff2f-4680-8656-9635a478fff6", + "fields": { + "created_date": "2020-03-03T15:51:33.199Z", + "modified_date": "2020-03-03T16:36:07.199Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "qual_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5441, + "class": "File", + "location": "bid://1443fcef-78eb-40eb-ab46-40b2214320c7" + }, + { + "size": 5444, + "class": "File", + "location": "bid://e96bb07e-b1d1-4a0f-803b-e92979450b14" + } + ], + "value": [ + { + "size": 5441, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$335d29f41a556438d1ae9adaaa6d29b9aa946c95", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5444, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$6628af559e634f866524bc5363c0e8bdfdf5f0b1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics" + } + ], + "files": [ + "1443fcef-78eb-40eb-ab46-40b2214320c7", + "e96bb07e-b1d1-4a0f-803b-e92979450b14" + ] + } + }, + { + "model": "runner.port", + "pk": "7e98188c-32ed-4641-addc-70e550024005", + "fields": { + "created_date": "2020-03-03T15:51:33.203Z", + "modified_date": "2020-03-03T16:36:07.208Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "qual_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8249, + "class": "File", + "location": "bid://472bd390-fca8-404d-b55e-c610b1a2dcb6" + }, + { + "size": 8311, + "class": "File", + "location": "bid://247fb744-857f-4c3e-a920-1fea2701fde1" + } + ], + "value": [ + { + "size": 8249, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$c2b5037d8d8ffe00f343f32c85d63687b524dd5e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8311, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$998372c646dc8f797bfc6191ec6a2cabb007e445", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "files": [ + "247fb744-857f-4c3e-a920-1fea2701fde1", + "472bd390-fca8-404d-b55e-c610b1a2dcb6" + ] + } + }, + { + "model": "runner.port", + "pk": "57e747c9-00bc-4f90-b073-72becbfd05b6", + "fields": { + "created_date": "2020-03-03T15:51:33.207Z", + "modified_date": "2020-03-03T16:36:07.217Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "doc_basecounts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5173976, + "class": "File", + "location": "bid://2fba5e73-fe7f-4759-8c34-06fd86fa7885" + }, + { + "size": 5177530, + "class": "File", + "location": "bid://9a169250-e69b-483e-9dab-af304ea33df1" + } + ], + "value": [ + { + "size": 5173976, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_T001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$cf649d08ef5c428c31e009b4ea296e62638b5280", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_ALLANT_T001_d.rg.md_FP_base_counts" + }, + { + "size": 5177530, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_N002_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$4c56bce697b1cc4789125dd12501dd4aab8e456c", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_ALLANT_N002_d.rg.md_FP_base_counts" + } + ], + "files": [ + "2fba5e73-fe7f-4759-8c34-06fd86fa7885", + "9a169250-e69b-483e-9dab-af304ea33df1" + ] + } + }, + { + "model": "runner.port", + "pk": "82557497-d090-4b06-8e5b-ad9aa1bf7129", + "fields": { + "created_date": "2020-03-03T15:51:33.216Z", + "modified_date": "2020-03-03T16:36:07.232Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "gcbias_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5981, + "class": "File", + "location": "bid://59fb9d8b-d738-40e8-9774-991702d5a4f7" + }, + { + "size": 6017, + "class": "File", + "location": "bid://fb8faf59-e51f-48cd-883e-957f56fcd6d9" + } + ], + "value": [ + { + "size": 5981, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$a8e7d4cdd24aa1895af342067de9f59446c2b137", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 6017, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.gcbiasmetrics", + "checksum": "sha1$60453940d907de3970ebb8796234a8361dc560f0", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "59fb9d8b-d738-40e8-9774-991702d5a4f7", + "fb8faf59-e51f-48cd-883e-957f56fcd6d9" + ] + } + }, + { + "model": "runner.port", + "pk": "3f374832-54b5-41e9-9c79-63d8592a8054", + "fields": { + "created_date": "2020-03-03T15:51:33.220Z", + "modified_date": "2020-03-03T16:36:07.240Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "gcbias_summary", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 1195, + "class": "File", + "location": "bid://1b85855c-2a6e-4640-b43f-bd35bb7229a0" + }, + { + "size": 1194, + "class": "File", + "location": "bid://a4457074-8ae2-4b85-8372-829b94ed43ec" + } + ], + "value": [ + { + "size": 1195, + "class": "File", + "nameext": ".summary", + "basename": "s_C_ALLANT_T001_d.rg.md.gcbias.summary", + "checksum": "sha1$4539160ca2b58b7d730f491d838e7d987080a350", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.gcbias.summary", + "nameroot": "s_C_ALLANT_T001_d.rg.md.gcbias" + }, + { + "size": 1194, + "class": "File", + "nameext": ".summary", + "basename": "s_C_ALLANT_N002_d.rg.md.gcbias.summary", + "checksum": "sha1$49a38a9baef003efafa40a1375bb5c991c9fd418", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.gcbias.summary", + "nameroot": "s_C_ALLANT_N002_d.rg.md.gcbias" + } + ], + "files": [ + "1b85855c-2a6e-4640-b43f-bd35bb7229a0", + "a4457074-8ae2-4b85-8372-829b94ed43ec" + ] + } + }, + { + "model": "runner.port", + "pk": "91f0079c-ae6d-4e9f-96c4-d69a17ada4a4", + "fields": { + "created_date": "2020-03-03T15:51:33.223Z", + "modified_date": "2020-03-03T16:36:07.249Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "conpair_pileups", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 48680, + "class": "File", + "location": "bid://0d651786-9830-4e96-8b1d-df723def48c6" + }, + { + "size": 92666, + "class": "File", + "location": "bid://6ed450c2-305c-4d6b-9799-3b9e4ffcf62e" + } + ], + "value": [ + { + "size": 48680, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_ALLANT_T001_d.rg.md.pileup", + "checksum": "sha1$5130aba435a8c4a1038c5c6f057e2c83d1166563", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.pileup", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 92666, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_ALLANT_N002_d.rg.md.pileup", + "checksum": "sha1$33be9aebd5b6cd314d2c223fe92cc4f6346d5fb8", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.pileup", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "0d651786-9830-4e96-8b1d-df723def48c6", + "6ed450c2-305c-4d6b-9799-3b9e4ffcf62e" + ] + } + }, + { + "model": "runner.port", + "pk": "0be334e8-7351-4594-a4e4-5ecfbfe559bc", + "fields": { + "created_date": "2020-03-03T15:51:33.232Z", + "modified_date": "2020-03-03T16:36:07.263Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "mutect_callstats", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 153557, + "class": "File", + "location": "bid://28f96b87-9542-48b3-a276-edfe8a3e3865" + }, + "value": { + "size": 153557, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$c3da456c0a57a480c0aada1ded5444300407c797", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.txt", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "28f96b87-9542-48b3-a276-edfe8a3e3865" + ] + } + }, + { + "model": "runner.port", + "pk": "de2fb33b-3caf-45b3-abbc-5073fa87ecc5", + "fields": { + "created_date": "2020-03-03T15:51:33.239Z", + "modified_date": "2020-03-03T16:36:07.278Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "combine_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 11199, + "class": "File", + "location": "bid://d6e63b33-18ae-4bd7-b6ff-9d53f67f20fd", + "secondaryFiles": [ + { + "size": 715, + "class": "File", + "location": "bid://58432bc0-f1d3-4dae-a214-9ee1aeb8a3f5" + } + ] + }, + "value": { + "size": 11199, + "class": "File", + "nameext": ".gz", + "basename": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz", + "checksum": "sha1$8dcd7f87b0bec6a93a7561668f1580118c445622", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz", + "nameroot": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 715, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$f3d165d1371633cb1ed38a97a31d0ff993be8797", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz.tbi", + "nameroot": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz" + } + ] + }, + "files": [ + "58432bc0-f1d3-4dae-a214-9ee1aeb8a3f5", + "d6e63b33-18ae-4bd7-b6ff-9d53f67f20fd" + ] + } + }, + { + "model": "runner.port", + "pk": "cb32a707-9b3d-458b-acd3-656fc96e5994", + "fields": { + "created_date": "2020-03-03T15:51:33.244Z", + "modified_date": "2020-03-03T16:36:07.285Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "annotate_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 45215, + "class": "File", + "location": "bid://f2fc60bd-d341-4f0b-81fd-41e39f83d3eb" + }, + "value": { + "size": 45215, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants.vcf", + "checksum": "sha1$6d34e44cd0a51b93d998e1c2675e5ba3604c09e8", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants.vcf", + "nameroot": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants" + }, + "files": [ + "f2fc60bd-d341-4f0b-81fd-41e39f83d3eb" + ] + } + }, + { + "model": "runner.port", + "pk": "0aee98d8-edfb-450d-87b6-53fc254e652f", + "fields": { + "created_date": "2020-03-03T15:51:33.248Z", + "modified_date": "2020-03-03T16:36:07.292Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "vardict_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 8489, + "class": "File", + "location": "bid://e9ad81bc-36fa-4ca4-924e-03217ac90f1e", + "secondaryFiles": [ + { + "size": 717, + "class": "File", + "location": "bid://b16f3245-ec79-4a0a-a063-d63022b55b59" + } + ] + }, + "value": { + "size": 8489, + "class": "File", + "nameext": ".gz", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$1e97e86829a56d5d5b52cf69bf411b901c540b7f", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 717, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$14dc51357257af13f684178b89cc794bc86b1570", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "b16f3245-ec79-4a0a-a063-d63022b55b59", + "e9ad81bc-36fa-4ca4-924e-03217ac90f1e" + ] + } + }, + { + "model": "runner.port", + "pk": "cbdd30ef-ab91-4fd9-9b12-f74d6e117da9", + "fields": { + "created_date": "2020-03-03T15:51:33.253Z", + "modified_date": "2020-03-03T16:36:07.302Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "mutect_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 3364, + "class": "File", + "location": "bid://52670690-7584-4bbe-a742-b574e2906ee0", + "secondaryFiles": [ + { + "size": 175, + "class": "File", + "location": "bid://88f63148-77ea-4168-b8d6-186029eeea1b" + } + ] + }, + "value": { + "size": 3364, + "class": "File", + "nameext": ".gz", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$e92cd3cd1f9126a89a0d586a01fbbfec8c59118f", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 175, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$a12034d6238ffc26e24c2bdc7fc14102d6eeeb05", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "52670690-7584-4bbe-a742-b574e2906ee0", + "88f63148-77ea-4168-b8d6-186029eeea1b" + ] + } + }, + { + "model": "runner.port", + "pk": "4c7cdb90-0365-4497-8c41-31e285278c03", + "fields": { + "created_date": "2020-03-03T15:51:33.256Z", + "modified_date": "2020-03-03T16:36:07.312Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "facets_png", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 57706, + "class": "File", + "location": "bid://c9ab61ad-c20e-443a-bbc2-b0667a8d2ad0" + }, + { + "size": 55138, + "class": "File", + "location": "bid://418838d1-4f3a-41b7-8625-95c333573a1d" + } + ], + "value": [ + { + "size": 57706, + "class": "File", + "nameext": ".png", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$049d66f6227b90ec362adcd9a548db3fc84e0103", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF.png", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 55138, + "class": "File", + "nameext": ".png", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$66bc49f36660bf3612a9e14f42fc4b04aa671813", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF.png", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "files": [ + "418838d1-4f3a-41b7-8625-95c333573a1d", + "c9ab61ad-c20e-443a-bbc2-b0667a8d2ad0" + ] + } + }, + { + "model": "runner.port", + "pk": "dba047b9-2610-4445-9482-0ec8e4bde132", + "fields": { + "created_date": "2020-03-03T15:51:33.263Z", + "modified_date": "2020-03-03T16:36:07.328Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "facets_txt_purity", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 272, + "class": "File", + "location": "bid://b4bdf448-5143-441a-a293-ca6406aa5570" + }, + "value": { + "size": 272, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$05d7689fd2d95572e54d1c87b033b150b555f4a1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf.txt", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf" + }, + "files": [ + "b4bdf448-5143-441a-a293-ca6406aa5570" + ] + } + }, + { + "model": "runner.port", + "pk": "e4e54a6c-4967-410f-97e7-5814f2767c47", + "fields": { + "created_date": "2020-03-03T15:51:33.267Z", + "modified_date": "2020-03-03T16:36:07.339Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "facets_out", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 580, + "class": "File", + "location": "bid://c44d24c7-d759-428a-8900-f5cefffe89aa" + }, + { + "size": 580, + "class": "File", + "location": "bid://d5e3ae2f-e324-4f7e-a273-e36962d4b264" + } + ], + "value": [ + { + "size": 580, + "class": "File", + "nameext": ".out", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$049ad328c87b935854addd937dee3235e1eda016", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.out", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 580, + "class": "File", + "nameext": ".out", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$ed761951bdebb4213d1492fe4ceed5b23c77659f", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.out", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "c44d24c7-d759-428a-8900-f5cefffe89aa", + "d5e3ae2f-e324-4f7e-a273-e36962d4b264" + ] + } + }, + { + "model": "runner.port", + "pk": "52298f8f-3e5a-43b3-b339-7c485efe0385", + "fields": { + "created_date": "2020-03-03T15:51:33.271Z", + "modified_date": "2020-03-03T16:36:07.348Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "facets_rdata", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 27113, + "class": "File", + "location": "bid://fd222279-2027-4b73-b6b3-4b6789104d7a" + }, + { + "size": 27043, + "class": "File", + "location": "bid://d029bc47-903b-49fb-b882-bc5c3c2a6f88" + } + ], + "value": [ + { + "size": 27113, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$674cc83029e73aecd3212049170aad144d006a33", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.Rdata", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 27043, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$20abe4b0bd0c25391f29b2fbf66bc228bc59814d", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.Rdata", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "d029bc47-903b-49fb-b882-bc5c3c2a6f88", + "fd222279-2027-4b73-b6b3-4b6789104d7a" + ] + } + }, + { + "model": "runner.port", + "pk": "89e638c4-f7b7-43e7-a69d-7fe1109581c6", + "fields": { + "created_date": "2020-03-03T15:51:33.274Z", + "modified_date": "2020-03-03T16:36:07.356Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "facets_seg", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 229, + "class": "File", + "location": "bid://d69772ec-1943-4902-9d7e-1937b0a038c7" + }, + { + "size": 107, + "class": "File", + "location": "bid://fff9d989-b258-4d5a-8996-f985516baa06" + } + ], + "value": [ + { + "size": 229, + "class": "File", + "nameext": ".seg", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$2cd8276e43bb884232d8ac160046bfb2e052d51f", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.seg", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 107, + "class": "File", + "nameext": ".seg", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$db487a0aeb3d1cb191930125da911bd8580e2907", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.seg", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "d69772ec-1943-4902-9d7e-1937b0a038c7", + "fff9d989-b258-4d5a-8996-f985516baa06" + ] + } + }, + { + "model": "runner.port", + "pk": "83f53878-d050-4699-95d2-491a12d6e4eb", + "fields": { + "created_date": "2020-03-03T15:51:33.282Z", + "modified_date": "2020-03-03T16:36:07.369Z", + "run": "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2", + "name": "maf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 105617, + "class": "File", + "location": "bid://8f768051-9e95-4334-b8ec-0b0e171dd9cc" + }, + "value": { + "size": 105617, + "class": "File", + "nameext": ".maf", + "basename": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts.maf", + "checksum": "sha1$485415d59a040cd7296685452bd778b3f34f8147", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts.maf", + "nameroot": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts" + }, + "files": [ + "8f768051-9e95-4334-b8ec-0b0e171dd9cc" + ] + } + }, + { + "model": "file_system.file", + "pk": "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd", + "fields": { + "created_date": "2019-10-24T00:23:16.737Z", + "modified_date": "2019-10-24T00:23:16.737Z", + "file_name": "human.hg19.excl.tsv", + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.tsv", + "file_type": 9, + "size": 6984, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "92bff766-15fd-4316-8977-77afcef97dae", + "fields": { + "created_date": "2019-12-09T23:31:22.151Z", + "modified_date": "2019-12-09T23:31:22.151Z", + "file_name": "hotspot-list-union-v1-v2.maf", + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf", + "file_type": 24, + "size": 624846, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "14b45ffc-8797-40dd-b456-669bf79c22bb", + "fields": { + "created_date": "2019-10-24T00:23:28.565Z", + "modified_date": "2019-10-24T00:23:28.565Z", + "file_name": "picard_baits.interval_list", + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/picard_baits.interval_list", + "file_type": 7, + "size": 332599, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dce51627-5764-429b-ba52-f9cab17d967d", + "fields": { + "created_date": "2019-10-24T00:23:28.892Z", + "modified_date": "2019-10-24T00:23:28.892Z", + "file_name": "picard_targets.interval_list", + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/picard_targets.interval_list", + "file_type": 7, + "size": 198736, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "3f2fcb1e-cdf4-4d71-8369-04197b5ef7ff", + "fields": { + "created_date": "2019-10-24T00:23:27.976Z", + "modified_date": "2019-10-24T00:23:27.976Z", + "file_name": "FP_tiling_genotypes.txt", + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/FP_tiling_genotypes.txt", + "file_type": 10, + "size": 16088, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "fields": { + "created_date": "2019-10-24T00:23:15.075Z", + "modified_date": "2019-10-24T00:23:15.075Z", + "file_name": "refGene_b37.sorted.txt", + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.txt", + "file_type": 10, + "size": 9953757, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "584079c8-13af-4816-9ad3-50ce86e13934", + "fields": { + "created_date": "2019-10-24T00:23:17.243Z", + "modified_date": "2019-10-24T00:23:17.243Z", + "file_name": "dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "file_type": 11, + "size": 1015019014, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "d058dd8e-6097-4556-b7e7-7c2184789036", + "fields": { + "created_date": "2019-10-24T00:23:28.279Z", + "modified_date": "2019-10-24T00:23:28.279Z", + "file_name": "FP_tiling_intervals.list", + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/FP_tiling_intervals.list", + "file_type": 7, + "size": 21700, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "96e3a791-2bc7-45f8-acc6-e519a29d5d0b", + "fields": { + "created_date": "2019-12-06T20:05:01.506Z", + "modified_date": "2019-12-06T20:05:01.506Z", + "file_name": "b37.fasta", + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta", + "file_type": 2, + "size": 3189750467, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7", + "fields": { + "created_date": "2019-10-24T00:23:19.218Z", + "modified_date": "2019-10-24T00:23:19.218Z", + "file_name": "GRCm38.fasta", + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta", + "file_type": 2, + "size": 2769885087, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "87b6a57c-f15b-49eb-9d22-d3893d2e00ef", + "fields": { + "created_date": "2019-12-09T23:34:12.885Z", + "modified_date": "2019-12-09T23:34:12.886Z", + "file_name": "hapmap_3.3.b37.vcf", + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf", + "file_type": 11, + "size": 225898391, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "914dce04-bc41-427e-9b6c-3084bfa61250", + "fields": { + "created_date": "2019-12-09T23:37:00.416Z", + "modified_date": "2019-12-09T23:37:00.416Z", + "file_name": "dbsnp_138.b37.excluding_sites_after_129.vcf", + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf", + "file_type": 11, + "size": 2432705678, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c868b6e9-92bd-4855-9726-7945e4471973", + "fields": { + "created_date": "2019-12-10T15:40:05.224Z", + "modified_date": "2019-12-10T15:40:05.224Z", + "file_name": "Mills_and_1000G_gold_standard.indels.b37.vcf", + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf", + "file_type": 11, + "size": 86369975, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "6f644f7f-a7b7-4573-a40a-6c5838f58b75", + "fields": { + "created_date": "2019-12-10T15:41:25.361Z", + "modified_date": "2019-12-10T15:41:25.361Z", + "file_name": "1000G_phase1.snps.high_confidence.b37.vcf", + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf", + "file_type": 11, + "size": 7313069069, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "100204c9-c560-43d9-ab4d-8c03bc207f4e", + "fields": { + "created_date": "2019-12-10T15:41:47.402Z", + "modified_date": "2019-12-10T15:41:47.402Z", + "file_name": "CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "file_type": 11, + "size": 112402812, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2", + "fields": { + "created_date": "2019-12-10T15:42:27.587Z", + "modified_date": "2019-12-10T15:42:27.587Z", + "file_name": "ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "file_type": 11, + "size": 337197976, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b02c07f0-326a-44b4-9980-62954027f342", + "fields": { + "created_date": "2020-01-14T21:19:56.882Z", + "modified_date": "2020-01-14T21:19:56.882Z", + "file_name": "DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz", + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz", + "file_type": 1, + "size": 9695259, + "file_group": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe" + } + }, + { + "model": "file_system.file", + "pk": "450fc99c-c84f-4b4e-9a32-1e6ca6341cad", + "fields": { + "created_date": "2020-01-14T21:19:57.252Z", + "modified_date": "2020-01-14T21:19:57.253Z", + "file_name": "DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz", + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz", + "file_type": 1, + "size": 8968582, + "file_group": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe" + } + }, + { + "model": "file_system.file", + "pk": "0edc3e64-6cfc-4f15-a3cb-6f90fdf01d15", + "fields": { + "created_date": "2020-01-14T21:19:57.591Z", + "modified_date": "2020-01-14T21:19:57.591Z", + "file_name": "DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz", + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz", + "file_type": 1, + "size": 8881738, + "file_group": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe" + } + }, + { + "model": "file_system.file", + "pk": "04f44221-a5d5-4b4c-84d4-92c8c8a4da5a", + "fields": { + "created_date": "2020-01-14T21:19:56.487Z", + "modified_date": "2020-01-14T21:19:56.487Z", + "file_name": "DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz", + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz", + "file_type": 1, + "size": 9446362, + "file_group": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe" + } + }, + { + "model": "file_system.file", + "pk": "62366951-1c94-4b75-82c6-384d5359cebe", + "fields": { + "created_date": "2019-10-24T00:23:51.267Z", + "modified_date": "2019-10-24T00:23:51.267Z", + "file_name": "s_C_U8A7CR_N001_d.Group14.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U8A7CR_N001_d.Group14.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2450372054, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e339ee8d-4e73-4ca5-907a-eb8296c1cd18", + "fields": { + "created_date": "2019-10-24T00:23:49.956Z", + "modified_date": "2019-10-24T00:23:49.956Z", + "file_name": "s_C_MWF8PH_N001_d.Group6.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_MWF8PH_N001_d.Group6.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2143139421, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "ebbb6238-0bdb-4e28-9040-9e257ffb3407", + "fields": { + "created_date": "2019-10-24T00:23:50.196Z", + "modified_date": "2019-10-24T00:23:50.196Z", + "file_name": "s_C_NJHH88_N001_d.Group16.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NJHH88_N001_d.Group16.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2613987166, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "7c918d29-514c-447b-81ee-8c7c36ee098c", + "fields": { + "created_date": "2019-10-24T00:23:44.904Z", + "modified_date": "2019-10-24T00:23:44.904Z", + "file_name": "s_C_09TAFV_N001_d.Group20.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_09TAFV_N001_d.Group20.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2298166927, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f70c128b-3466-4399-99d9-4bf33a5a53fe", + "fields": { + "created_date": "2019-10-24T00:23:51.016Z", + "modified_date": "2019-10-24T00:23:51.016Z", + "file_name": "s_C_U53DXH_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U53DXH_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2943821584, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8d2afc5f-7fc2-4584-a169-bd978314ae43", + "fields": { + "created_date": "2019-10-24T00:23:47.452Z", + "modified_date": "2019-10-24T00:23:47.452Z", + "file_name": "s_C_CTR0E9_N001_d.Group25.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_CTR0E9_N001_d.Group25.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1906184759, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "be0ed0ea-33f6-4331-9af9-6439f7b149d0", + "fields": { + "created_date": "2019-10-24T00:23:45.392Z", + "modified_date": "2019-10-24T00:23:45.392Z", + "file_name": "s_C_29F7HE_N001_d.Group17.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_29F7HE_N001_d.Group17.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1872524914, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "0d184175-1f65-4af0-b67d-c93c7d50988a", + "fields": { + "created_date": "2019-10-24T00:23:50.456Z", + "modified_date": "2019-10-24T00:23:50.456Z", + "file_name": "s_C_NR3W32_N001_d.Group21.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NR3W32_N001_d.Group21.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3185868859, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b6ae85ba-fd31-475a-b0fe-2a32789a4692", + "fields": { + "created_date": "2019-10-24T00:23:43.866Z", + "modified_date": "2019-10-24T00:23:43.866Z", + "file_name": "s_C_006715_N001_d.Group6.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006715_N001_d.Group6.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3817576500, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "eaec3382-528f-4b6b-acff-b718c84a8980", + "fields": { + "created_date": "2019-10-24T00:23:42.542Z", + "modified_date": "2019-10-24T00:23:42.542Z", + "file_name": "s_C_006709_N001_d.Group11.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006709_N001_d.Group11.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3506739569, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c033a8df-2197-4e99-95ba-b47e5659621c", + "fields": { + "created_date": "2019-10-24T00:23:51.511Z", + "modified_date": "2019-10-24T00:23:51.511Z", + "file_name": "s_C_VXC8TK_N001_d.Group24.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_VXC8TK_N001_d.Group24.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2842957613, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8e9b5b36-da56-4dc8-a895-0ff14a5457bc", + "fields": { + "created_date": "2019-10-24T00:23:48.746Z", + "modified_date": "2019-10-24T00:23:48.746Z", + "file_name": "s_C_JFM1K9_N001_d.Group3.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JFM1K9_N001_d.Group3.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1504713508, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e800d375-bd52-4829-9d37-18194d0e8824", + "fields": { + "created_date": "2019-10-24T00:23:42.781Z", + "modified_date": "2019-10-24T00:23:42.781Z", + "file_name": "s_C_006710_N001_d.Group5.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006710_N001_d.Group5.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3554787689, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "84c1c4a4-8ad9-4df8-a30d-fd5d9ec58cc7", + "fields": { + "created_date": "2019-10-24T00:23:48.265Z", + "modified_date": "2019-10-24T00:23:48.265Z", + "file_name": "s_C_FWK8C0_N001_d.Group8.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FWK8C0_N001_d.Group8.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2337197309, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "9956c92d-395c-49bd-8806-93e94d66f91c", + "fields": { + "created_date": "2019-10-24T00:23:43.368Z", + "modified_date": "2019-10-24T00:23:43.368Z", + "file_name": "s_C_006713_N001_d.Group10.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006713_N001_d.Group10.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 357147001, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8a8dd9e3-1970-41d9-abfe-8d5f62745cbf", + "fields": { + "created_date": "2019-10-24T00:23:49.232Z", + "modified_date": "2019-10-24T00:23:49.232Z", + "file_name": "s_C_KAT85C_N001_d.Group15.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_KAT85C_N001_d.Group15.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2332122557, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "29f16470-1721-4957-9fa4-c42a685e65e9", + "fields": { + "created_date": "2019-10-24T00:23:50.696Z", + "modified_date": "2019-10-24T00:23:50.696Z", + "file_name": "s_C_P10A8A_N001_d.Group29.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_P10A8A_N001_d.Group29.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1893685916, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "31f3fa2b-face-431d-ac31-5e4aa5c1f534", + "fields": { + "created_date": "2019-10-24T00:23:52.309Z", + "modified_date": "2019-10-24T00:23:52.309Z", + "file_name": "s_C_XXC7N6_N001_d.Group12.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_XXC7N6_N001_d.Group12.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2076693674, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "d959d541-f891-441d-9951-a6d1df49fb91", + "fields": { + "created_date": "2019-10-24T00:23:45.638Z", + "modified_date": "2019-10-24T00:23:45.638Z", + "file_name": "s_C_2J273K_N001_d.Group22.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_2J273K_N001_d.Group22.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2587901961, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f085a161-0f9e-4e7d-bef4-dce17f3cf311", + "fields": { + "created_date": "2019-10-24T00:23:43.018Z", + "modified_date": "2019-10-24T00:23:43.018Z", + "file_name": "s_C_006711_N001_d.Group7.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006711_N001_d.Group7.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 4384120977, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "a4e02e9e-833e-4dfc-a8d8-caece136a2af", + "fields": { + "created_date": "2019-10-24T00:23:43.629Z", + "modified_date": "2019-10-24T00:23:43.629Z", + "file_name": "s_C_006714_N001_d.Group8.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006714_N001_d.Group8.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1685774338, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b4f708ff-8bea-47fc-8a4e-3ced60b817b1", + "fields": { + "created_date": "2019-10-24T00:23:47.702Z", + "modified_date": "2019-10-24T00:23:47.702Z", + "file_name": "s_C_DJE4C0_N001_d.Group8.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_DJE4C0_N001_d.Group8.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2049846455, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b75b9ba0-022c-4ec1-87f3-8c81d8b5d88b", + "fields": { + "created_date": "2019-10-24T00:23:45.879Z", + "modified_date": "2019-10-24T00:23:45.879Z", + "file_name": "s_C_32WX55_N001_d.Group17.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_32WX55_N001_d.Group17.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2054678576, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "13b6946e-c047-49b8-bac3-34efddb0847d", + "fields": { + "created_date": "2019-10-24T00:23:44.400Z", + "modified_date": "2019-10-24T00:23:44.400Z", + "file_name": "s_C_006717_N001_d.Group3.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006717_N001_d.Group3.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1873938178, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c0298d8e-2dcf-487b-a1c5-888522a55abc", + "fields": { + "created_date": "2019-10-24T00:23:48.989Z", + "modified_date": "2019-10-24T00:23:48.989Z", + "file_name": "s_C_JWYL4J_N001_d.Group19.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JWYL4J_N001_d.Group19.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2324784125, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "acccd858-813d-46c3-85da-d7063f051f89", + "fields": { + "created_date": "2019-10-24T00:23:46.115Z", + "modified_date": "2019-10-24T00:23:46.115Z", + "file_name": "s_C_3WFCFP_N001_d.Group24.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_3WFCFP_N001_d.Group24.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1507048799, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "54b4aef7-46f3-417b-949c-7d44d94b69df", + "fields": { + "created_date": "2019-10-24T00:23:46.903Z", + "modified_date": "2019-10-24T00:23:46.903Z", + "file_name": "s_C_96X4FW_N001_d.Group13.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_96X4FW_N001_d.Group13.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2972235408, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "7a71c994-7c88-4523-8abd-ae50d792ba19", + "fields": { + "created_date": "2019-10-24T00:23:46.359Z", + "modified_date": "2019-10-24T00:23:46.359Z", + "file_name": "s_C_4XFY8V_N001_d.Group2.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_4XFY8V_N001_d.Group2.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1702329989, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "312220bd-8bb6-41bd-817f-59217c364fdf", + "fields": { + "created_date": "2019-10-24T00:23:45.151Z", + "modified_date": "2019-10-24T00:23:45.151Z", + "file_name": "s_C_1FPU8J_N001_d.Group10.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_1FPU8J_N001_d.Group10.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1281116533, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "768c19d8-a4e6-4c14-86d9-8ac6fcd51798", + "fields": { + "created_date": "2019-10-24T00:23:49.472Z", + "modified_date": "2019-10-24T00:23:49.472Z", + "file_name": "s_C_LC80PX_N001_d.Group7.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LC80PX_N001_d.Group7.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2999188032, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f4aeecab-b064-4935-a2af-014e633d5ef2", + "fields": { + "created_date": "2019-10-24T00:23:44.108Z", + "modified_date": "2019-10-24T00:23:44.108Z", + "file_name": "s_C_006716_N001_d.Group4.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006716_N001_d.Group4.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3542807384, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "fd08b546-720f-4622-b79d-693936d2b608", + "fields": { + "created_date": "2019-10-24T00:23:48.002Z", + "modified_date": "2019-10-24T00:23:48.002Z", + "file_name": "s_C_FDR1YC_N001_d.Group27.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FDR1YC_N001_d.Group27.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1438785234, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "baa2b1ea-6954-4d48-87f6-017a1786b4eb", + "fields": { + "created_date": "2019-10-24T00:23:51.753Z", + "modified_date": "2019-10-24T00:23:51.753Z", + "file_name": "s_C_W0TXP0_N001_d.Group22.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_W0TXP0_N001_d.Group22.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1841725480, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "fee5555e-ca62-4213-ae2f-a86e45f1ab02", + "fields": { + "created_date": "2019-10-24T00:23:52.057Z", + "modified_date": "2019-10-24T00:23:52.057Z", + "file_name": "s_C_WWTK32_N001_d.Group18.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_WWTK32_N001_d.Group18.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1677939673, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "7e7c92fd-1653-4de5-b0ad-fb1b35eafd95", + "fields": { + "created_date": "2019-10-24T00:23:44.656Z", + "modified_date": "2019-10-24T00:23:44.656Z", + "file_name": "s_C_006718_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006718_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 4023855606, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "87663bfc-8a6f-4c30-9528-85c4c9859abe", + "fields": { + "created_date": "2019-10-24T00:23:49.716Z", + "modified_date": "2019-10-24T00:23:49.716Z", + "file_name": "s_C_LNNV52_N001_d.Group26.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LNNV52_N001_d.Group26.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2013280397, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "4af32904-03d2-4646-822d-8e520239421f", + "fields": { + "created_date": "2019-10-24T00:23:42.302Z", + "modified_date": "2019-10-24T00:23:42.302Z", + "file_name": "s_C_006708_N001_d.Group9.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006708_N001_d.Group9.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3727525387, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "938e0e74-bd4a-4d3f-b9e3-c327acad3f44", + "fields": { + "created_date": "2019-10-24T00:23:48.506Z", + "modified_date": "2019-10-24T00:23:48.506Z", + "file_name": "s_C_HRE3UJ_N001_d.Group9.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_HRE3UJ_N001_d.Group9.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1179733581, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "63fcfa9f-b2b1-446b-b1e5-0f58803fb2f4", + "fields": { + "created_date": "2019-10-24T00:23:46.665Z", + "modified_date": "2019-10-24T00:23:46.665Z", + "file_name": "s_C_7XDAJW_N001_d.Group15.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_7XDAJW_N001_d.Group15.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1837781380, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "d78b21a5-d156-4d96-b532-d7788872f292", + "fields": { + "created_date": "2019-10-24T00:23:47.142Z", + "modified_date": "2019-10-24T00:23:47.142Z", + "file_name": "s_C_A8N9WX_N001_d.Group12.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_A8N9WX_N001_d.Group12.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2093758629, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.filemetadata", + "pk": "c572a28f-c8a7-4fae-b6a5-b1de88f49eda", + "fields": { + "created_date": "2019-10-24T00:23:16.747Z", + "modified_date": "2019-10-24T00:23:16.747Z", + "file": "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "delly" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d82d6bf2-1014-47b5-9475-95ad04a3c729", + "fields": { + "created_date": "2019-12-09T23:31:22.187Z", + "modified_date": "2019-12-09T23:31:22.187Z", + "file": "92bff766-15fd-4316-8977-77afcef97dae", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "05313201-3be2-4fdf-ad3f-65bc4ce331c6", + "fields": { + "created_date": "2019-10-24T00:23:28.575Z", + "modified_date": "2019-10-24T00:23:28.575Z", + "file": "14b45ffc-8797-40dd-b456-669bf79c22bb", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "baits_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "bdbfb99d-dcda-4983-b6bc-64580913e7aa", + "fields": { + "created_date": "2019-10-24T00:23:28.902Z", + "modified_date": "2019-10-24T00:23:28.902Z", + "file": "dce51627-5764-429b-ba52-f9cab17d967d", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "targets_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "505c7e2e-20b1-4eef-8ed2-759d0247cd77", + "fields": { + "created_date": "2019-10-24T00:23:27.986Z", + "modified_date": "2019-10-24T00:23:27.987Z", + "file": "3f2fcb1e-cdf4-4d71-8369-04197b5ef7ff", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "FP_genotypes" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "10454e5e-9a20-4beb-af95-fcf2d856ecaf", + "fields": { + "created_date": "2019-10-24T00:23:15.094Z", + "modified_date": "2019-10-24T00:23:15.094Z", + "file": "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "refseq" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d386a959-9036-4eaf-8793-4ee7aaff0c07", + "fields": { + "created_date": "2019-10-24T00:23:17.253Z", + "modified_date": "2019-10-24T00:23:17.253Z", + "file": "584079c8-13af-4816-9ad3-50ce86e13934", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "facets_snps" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b3534d26-d612-4fdc-bf12-ee0eba236db8", + "fields": { + "created_date": "2019-10-24T00:23:28.289Z", + "modified_date": "2019-10-24T00:23:28.289Z", + "file": "d058dd8e-6097-4556-b7e7-7c2184789036", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "FP_intervals" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "61a79866-b376-47e4-9d2e-f48ba2db7eba", + "fields": { + "created_date": "2019-12-06T20:05:01.781Z", + "modified_date": "2019-12-06T20:05:01.781Z", + "file": "96e3a791-2bc7-45f8-acc6-e519a29d5d0b", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2257c5e7-356a-422e-b409-ecddac244f00", + "fields": { + "created_date": "2019-10-24T00:23:19.228Z", + "modified_date": "2019-10-24T00:23:19.228Z", + "file": "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7", + "version": 0, + "metadata": { + "genome": "GRCh38", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "25dc1fa1-b0d5-4924-9ccb-bb18ec59f4ac", + "fields": { + "created_date": "2019-12-09T23:34:12.902Z", + "modified_date": "2019-12-09T23:34:12.902Z", + "file": "87b6a57c-f15b-49eb-9d22-d3893d2e00ef", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ad10ee7-c875-46cb-9a69-57acd461cf41", + "fields": { + "created_date": "2019-12-09T23:37:00.429Z", + "modified_date": "2019-12-09T23:37:00.429Z", + "file": "914dce04-bc41-427e-9b6c-3084bfa61250", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ae8c6fe5-f9e3-4650-9f09-8906342e4783", + "fields": { + "created_date": "2019-12-10T15:40:05.251Z", + "modified_date": "2019-12-10T15:40:05.251Z", + "file": "c868b6e9-92bd-4855-9726-7945e4471973", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "abfd67dc-9139-4165-aa46-de34de1903d6", + "fields": { + "created_date": "2019-12-10T15:41:25.375Z", + "modified_date": "2019-12-10T15:41:25.375Z", + "file": "6f644f7f-a7b7-4573-a40a-6c5838f58b75", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "de7089b7-8a69-4948-b601-5b965e4e9dae", + "fields": { + "created_date": "2019-12-10T15:41:47.412Z", + "modified_date": "2019-12-10T15:41:47.412Z", + "file": "100204c9-c560-43d9-ab4d-8c03bc207f4e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "300442b0-9009-4d2c-9dc1-c226a7c09ee8", + "fields": { + "created_date": "2019-12-10T15:42:27.601Z", + "modified_date": "2019-12-10T15:42:27.601Z", + "file": "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a011d87a-fad3-405c-bed8-e8ef26ce5b16", + "fields": { + "created_date": "2020-01-14T21:19:56.908Z", + "modified_date": "2020-01-14T21:19:56.908Z", + "file": "b02c07f0-326a-44b4-9980-62954027f342", + "version": 0, + "metadata": { + "R": "R2", + "sex": "Unknown", + "runId": null, + "recipe": "CustomCapture", + "baitSet": "IMPACT468_BAITS", + "piEmail": "", + "runDate": null, + "runMode": null, + "species": "Human", + "platform": "MySequencingPlatform", + "sampleId": "ALN-TEST-02", + "barcodeId": null, + "libraryId": "MyLibraryId", + "patientId": "C-ALLANT", + "requestId": "ALN-REQ-ID", + "flowCellId": "MyFlowCellId", + "readLength": null, + "sampleName": "C-ALLANT-N002-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "", + "sampleClass": "Normal", + "barcodeIndex": "MyBarcodeIndex", + "labHeadEmail": "", + "oncoTreeCode": null, + "preservation": "FFPE", + "sampleOrigin": "Cells", + "specimenType": "Blood", + "flowCellLanes": [], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "ALN_TEST_EXT_02", + "investigatorName": "", + "sequencingCenter": "MySequencingCenter", + "investigatorEmail": "", + "projectManagerName": "", + "investigatorSampleId": "ALN", + "captureConcentrationNm": null, + "libraryConcentrationNgul": null + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6cfdf466-7d3e-45b2-804b-b1c09593b611", + "fields": { + "created_date": "2020-01-14T21:19:57.261Z", + "modified_date": "2020-01-14T21:19:57.261Z", + "file": "450fc99c-c84f-4b4e-9a32-1e6ca6341cad", + "version": 0, + "metadata": { + "R": "R1", + "sex": "Unknown", + "runId": null, + "recipe": "CustomCapture", + "baitSet": "IMPACT468_BAITS", + "piEmail": "", + "runDate": null, + "runMode": null, + "species": "Human", + "platform": "MySequencingPlatform", + "sampleId": "ALN-TEST-01", + "barcodeId": null, + "libraryId": "MyLibraryId", + "patientId": "C-ALLANT", + "requestId": "ALN-REQ-ID", + "flowCellId": "MyFlowCellId", + "readLength": null, + "sampleName": "C-ALLANT-T001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "", + "sampleClass": "Tumor", + "barcodeIndex": "MyBarcodeIndex", + "labHeadEmail": "", + "oncoTreeCode": null, + "preservation": "FFPE", + "sampleOrigin": "Cells", + "specimenType": "Blood", + "flowCellLanes": [], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "ALN_TEST_EXT_01", + "investigatorName": "", + "sequencingCenter": "MySequencingCenter", + "investigatorEmail": "", + "projectManagerName": "", + "investigatorSampleId": "ALN", + "captureConcentrationNm": null, + "libraryConcentrationNgul": null + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4e2e01d6-78b1-4d57-bfd9-c6f37167a922", + "fields": { + "created_date": "2020-01-14T21:19:57.606Z", + "modified_date": "2020-01-14T21:19:57.606Z", + "file": "0edc3e64-6cfc-4f15-a3cb-6f90fdf01d15", + "version": 0, + "metadata": { + "R": "R2", + "sex": "Unknown", + "runId": null, + "recipe": "CustomCapture", + "baitSet": "IMPACT468_BAITS", + "piEmail": "", + "runDate": null, + "runMode": null, + "species": "Human", + "platform": "MySequencingPlatform", + "sampleId": "ALN-TEST-01", + "barcodeId": null, + "libraryId": "MyLibraryId", + "patientId": "C-ALLANT", + "requestId": "ALN-REQ-ID", + "flowCellId": "MyFlowCellId", + "readLength": null, + "sampleName": "C-ALLANT-T001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "", + "sampleClass": "Tumor", + "barcodeIndex": "MyBarcodeIndex", + "labHeadEmail": "", + "oncoTreeCode": null, + "preservation": "FFPE", + "sampleOrigin": "Cells", + "specimenType": "Blood", + "flowCellLanes": [], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "ALN_TEST_EXT_01", + "investigatorName": "", + "sequencingCenter": "MySequencingCenter", + "investigatorEmail": "", + "projectManagerName": "", + "investigatorSampleId": "ALN", + "captureConcentrationNm": null, + "libraryConcentrationNgul": null + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2f2bcc28-d7e7-4479-9214-ca88ee64f1ea", + "fields": { + "created_date": "2020-01-14T21:19:56.513Z", + "modified_date": "2020-01-14T21:19:56.513Z", + "file": "04f44221-a5d5-4b4c-84d4-92c8c8a4da5a", + "version": 0, + "metadata": { + "R": "R1", + "sex": "Unknown", + "runId": null, + "recipe": "CustomCapture", + "baitSet": "IMPACT468_BAITS", + "piEmail": "", + "runDate": null, + "runMode": null, + "species": "Human", + "platform": "MySequencingPlatform", + "sampleId": "ALN-TEST-02", + "barcodeId": null, + "libraryId": "MyLibraryId", + "patientId": "C-ALLANT", + "requestId": "ALN-REQ-ID", + "flowCellId": "MyFlowCellId", + "readLength": null, + "sampleName": "C-ALLANT-N002-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "", + "sampleClass": "Normal", + "barcodeIndex": "MyBarcodeIndex", + "labHeadEmail": "", + "oncoTreeCode": null, + "preservation": "FFPE", + "sampleOrigin": "Cells", + "specimenType": "Blood", + "flowCellLanes": [], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "ALN_TEST_EXT_02", + "investigatorName": "", + "sequencingCenter": "MySequencingCenter", + "investigatorEmail": "", + "projectManagerName": "", + "investigatorSampleId": "ALN", + "captureConcentrationNm": null, + "libraryConcentrationNgul": null + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4812ac7f-f576-4e53-a90b-4c28f1b08f01", + "fields": { + "created_date": "2019-10-24T00:23:51.276Z", + "modified_date": "2019-10-24T00:23:51.276Z", + "file": "62366951-1c94-4b75-82c6-384d5359cebe", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "253f37c6-304e-463b-9676-bb6defb7f0d4", + "fields": { + "created_date": "2019-10-24T00:23:49.965Z", + "modified_date": "2019-10-24T00:23:49.965Z", + "file": "e339ee8d-4e73-4ca5-907a-eb8296c1cd18", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "728b8284-c0d4-4fd9-b7a4-609435ec2979", + "fields": { + "created_date": "2019-10-24T00:23:50.226Z", + "modified_date": "2019-10-24T00:23:50.226Z", + "file": "ebbb6238-0bdb-4e28-9040-9e257ffb3407", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "aa492cac-94aa-477d-92fd-c6e55e5a5978", + "fields": { + "created_date": "2019-10-24T00:23:44.913Z", + "modified_date": "2019-10-24T00:23:44.913Z", + "file": "7c918d29-514c-447b-81ee-8c7c36ee098c", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "21cc598c-f11b-4306-8246-17333ffa7f7e", + "fields": { + "created_date": "2019-10-24T00:23:51.026Z", + "modified_date": "2019-10-24T00:23:51.026Z", + "file": "f70c128b-3466-4399-99d9-4bf33a5a53fe", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8a5b3c7a-940a-47fe-91ae-f9efd6216c37", + "fields": { + "created_date": "2019-10-24T00:23:47.462Z", + "modified_date": "2019-10-24T00:23:47.462Z", + "file": "8d2afc5f-7fc2-4584-a169-bd978314ae43", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5d118f3c-f527-4ea4-983f-9811a1d422ab", + "fields": { + "created_date": "2019-10-24T00:23:45.402Z", + "modified_date": "2019-10-24T00:23:45.403Z", + "file": "be0ed0ea-33f6-4331-9af9-6439f7b149d0", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "48056c0c-6027-4c08-9f56-38fbc7e35836", + "fields": { + "created_date": "2019-10-24T00:23:50.466Z", + "modified_date": "2019-10-24T00:23:50.466Z", + "file": "0d184175-1f65-4af0-b67d-c93c7d50988a", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a6596e2b-e457-40fd-9889-a8633882d577", + "fields": { + "created_date": "2019-10-24T00:23:43.880Z", + "modified_date": "2019-10-24T00:23:43.880Z", + "file": "b6ae85ba-fd31-475a-b0fe-2a32789a4692", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "89ff106b-a614-4ac3-9f6a-b01cc62d9cea", + "fields": { + "created_date": "2019-10-24T00:23:42.551Z", + "modified_date": "2019-10-24T00:23:42.551Z", + "file": "eaec3382-528f-4b6b-acff-b718c84a8980", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5bbc4dcc-09a8-4d82-b2c2-a795c8cf0eed", + "fields": { + "created_date": "2019-10-24T00:23:51.521Z", + "modified_date": "2019-10-24T00:23:51.521Z", + "file": "c033a8df-2197-4e99-95ba-b47e5659621c", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "868e69fb-7927-4a1f-82e9-e1753a9a4fa2", + "fields": { + "created_date": "2019-10-24T00:23:48.756Z", + "modified_date": "2019-10-24T00:23:48.756Z", + "file": "8e9b5b36-da56-4dc8-a895-0ff14a5457bc", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "298594e8-f70c-4f92-a515-1dc7f5d62f20", + "fields": { + "created_date": "2019-10-24T00:23:42.791Z", + "modified_date": "2019-10-24T00:23:42.791Z", + "file": "e800d375-bd52-4829-9d37-18194d0e8824", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "39382ef1-cff2-42b2-9b6c-0b2208971ec1", + "fields": { + "created_date": "2019-10-24T00:23:48.275Z", + "modified_date": "2019-10-24T00:23:48.275Z", + "file": "84c1c4a4-8ad9-4df8-a30d-fd5d9ec58cc7", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ee738a8-7a7d-4b25-853a-c37dfa1de00c", + "fields": { + "created_date": "2019-10-24T00:23:43.379Z", + "modified_date": "2019-10-24T00:23:43.379Z", + "file": "9956c92d-395c-49bd-8806-93e94d66f91c", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fbf33358-7170-4c48-8e0a-0d63042dc389", + "fields": { + "created_date": "2019-10-24T00:23:49.242Z", + "modified_date": "2019-10-24T00:23:49.242Z", + "file": "8a8dd9e3-1970-41d9-abfe-8d5f62745cbf", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1c7eb061-a230-437d-a859-9aac1c328b1e", + "fields": { + "created_date": "2019-10-24T00:23:50.707Z", + "modified_date": "2019-10-24T00:23:50.707Z", + "file": "29f16470-1721-4957-9fa4-c42a685e65e9", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "19015e03-e615-4d26-9d34-7aa48d1d3359", + "fields": { + "created_date": "2019-10-24T00:23:52.320Z", + "modified_date": "2019-10-24T00:23:52.320Z", + "file": "31f3fa2b-face-431d-ac31-5e4aa5c1f534", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4545c294-f6c2-4925-8765-11c4041ba4d5", + "fields": { + "created_date": "2019-10-24T00:23:45.649Z", + "modified_date": "2019-10-24T00:23:45.649Z", + "file": "d959d541-f891-441d-9951-a6d1df49fb91", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "11eb6f11-cc5d-4056-897f-0979376d3de4", + "fields": { + "created_date": "2019-10-24T00:23:43.028Z", + "modified_date": "2019-10-24T00:23:43.028Z", + "file": "f085a161-0f9e-4e7d-bef4-dce17f3cf311", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "cf52f0cd-20de-4d20-9d29-6cc033c05c51", + "fields": { + "created_date": "2019-10-24T00:23:43.639Z", + "modified_date": "2019-10-24T00:23:43.639Z", + "file": "a4e02e9e-833e-4dfc-a8d8-caece136a2af", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "949cb199-3543-4bf8-b137-eea46f4accbc", + "fields": { + "created_date": "2019-10-24T00:23:47.712Z", + "modified_date": "2019-10-24T00:23:47.712Z", + "file": "b4f708ff-8bea-47fc-8a4e-3ced60b817b1", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6705f6c0-2cb0-409d-b317-d9d5d9f60212", + "fields": { + "created_date": "2019-10-24T00:23:45.887Z", + "modified_date": "2019-10-24T00:23:45.888Z", + "file": "b75b9ba0-022c-4ec1-87f3-8c81d8b5d88b", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1d803949-9024-469b-a7b6-808058cca955", + "fields": { + "created_date": "2019-10-24T00:23:44.409Z", + "modified_date": "2019-10-24T00:23:44.410Z", + "file": "13b6946e-c047-49b8-bac3-34efddb0847d", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b51db15d-06da-464e-8ede-9465965e8f18", + "fields": { + "created_date": "2019-10-24T00:23:48.998Z", + "modified_date": "2019-10-24T00:23:48.998Z", + "file": "c0298d8e-2dcf-487b-a1c5-888522a55abc", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1ee14694-7d33-4a5e-a93e-aadf622994b9", + "fields": { + "created_date": "2019-10-24T00:23:46.124Z", + "modified_date": "2019-10-24T00:23:46.124Z", + "file": "acccd858-813d-46c3-85da-d7063f051f89", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d0677e55-144e-4338-b65d-4e11aeb88ecf", + "fields": { + "created_date": "2019-10-24T00:23:46.913Z", + "modified_date": "2019-10-24T00:23:46.913Z", + "file": "54b4aef7-46f3-417b-949c-7d44d94b69df", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4bd127e5-f269-42fb-bd5f-e7b4f0b90c69", + "fields": { + "created_date": "2019-10-24T00:23:46.369Z", + "modified_date": "2019-10-24T00:23:46.369Z", + "file": "7a71c994-7c88-4523-8abd-ae50d792ba19", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9cd76ae1-3556-4c80-8f76-7b1a6e6a18c0", + "fields": { + "created_date": "2019-10-24T00:23:45.161Z", + "modified_date": "2019-10-24T00:23:45.161Z", + "file": "312220bd-8bb6-41bd-817f-59217c364fdf", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "47620ea3-3b4b-4c50-82d6-723d5d5a16d8", + "fields": { + "created_date": "2019-10-24T00:23:49.482Z", + "modified_date": "2019-10-24T00:23:49.482Z", + "file": "768c19d8-a4e6-4c14-86d9-8ac6fcd51798", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "422186c3-692b-4ca7-a61b-681d6d5a6101", + "fields": { + "created_date": "2019-10-24T00:23:44.118Z", + "modified_date": "2019-10-24T00:23:44.118Z", + "file": "f4aeecab-b064-4935-a2af-014e633d5ef2", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a27bedd5-e3fd-4916-884b-437f88e20514", + "fields": { + "created_date": "2019-10-24T00:23:48.012Z", + "modified_date": "2019-10-24T00:23:48.012Z", + "file": "fd08b546-720f-4622-b79d-693936d2b608", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6865dfc6-0171-4325-934d-b3431d5b3f67", + "fields": { + "created_date": "2019-10-24T00:23:51.764Z", + "modified_date": "2019-10-24T00:23:51.764Z", + "file": "baa2b1ea-6954-4d48-87f6-017a1786b4eb", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d8b7c067-8a1b-488b-b914-01d277aa564c", + "fields": { + "created_date": "2019-10-24T00:23:52.067Z", + "modified_date": "2019-10-24T00:23:52.067Z", + "file": "fee5555e-ca62-4213-ae2f-a86e45f1ab02", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0f0f34b1-f88a-4a9a-91a6-3c59ea82a80a", + "fields": { + "created_date": "2019-10-24T00:23:44.666Z", + "modified_date": "2019-10-24T00:23:44.666Z", + "file": "7e7c92fd-1653-4de5-b0ad-fb1b35eafd95", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3c637c19-9874-46b4-adc0-973a7f88a47d", + "fields": { + "created_date": "2019-10-24T00:23:49.726Z", + "modified_date": "2019-10-24T00:23:49.726Z", + "file": "87663bfc-8a6f-4c30-9528-85c4c9859abe", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8c38eeeb-4eee-4a7e-aa37-ec6a402f1f4f", + "fields": { + "created_date": "2019-10-24T00:23:42.312Z", + "modified_date": "2019-10-24T00:23:42.312Z", + "file": "4af32904-03d2-4646-822d-8e520239421f", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c6b33d9e-a7b0-4a17-a22d-438ea21b9ba9", + "fields": { + "created_date": "2019-10-24T00:23:48.516Z", + "modified_date": "2019-10-24T00:23:48.516Z", + "file": "938e0e74-bd4a-4d3f-b9e3-c327acad3f44", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d9928da5-fba6-467a-a0c5-6287fbcb3168", + "fields": { + "created_date": "2019-10-24T00:23:46.675Z", + "modified_date": "2019-10-24T00:23:46.675Z", + "file": "63fcfa9f-b2b1-446b-b1e5-0f58803fb2f4", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4e7e10a9-2776-4b42-a724-44a1b8c342a4", + "fields": { + "created_date": "2019-10-24T00:23:47.152Z", + "modified_date": "2019-10-24T00:23:47.152Z", + "file": "d78b21a5-d156-4d96-b532-d7788872f292", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.file", + "pk": "da37fe31-85ff-40e1-93a6-c279a6a54d7d", + "fields": { + "created_date": "2020-03-03T16:36:06.015Z", + "modified_date": "2020-03-03T16:36:06.015Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.hsmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d1e657e2-1342-4106-9ea3-8fea5da81a3e", + "fields": { + "created_date": "2020-03-03T16:36:06.042Z", + "modified_date": "2020-03-03T16:36:06.042Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.hsmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "333f2ff8-c1d1-4464-afd1-002ee6c26410", + "fields": { + "created_date": "2020-03-03T16:36:06.391Z", + "modified_date": "2020-03-03T16:36:06.391Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.gcbias.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.gcbias.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "634bc305-0109-42f3-ae73-7cb38c7b816d", + "fields": { + "created_date": "2020-03-03T16:36:06.363Z", + "modified_date": "2020-03-03T16:36:06.363Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.gcbias.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.gcbias.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "da766256-deac-48be-97ae-cf5691abbe21", + "fields": { + "created_date": "2020-03-03T16:36:06.544Z", + "modified_date": "2020-03-03T16:36:06.544Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.vcf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e009f03e-0db8-4432-979e-50c3faa1ffee", + "fields": { + "created_date": "2020-03-03T16:36:06.575Z", + "modified_date": "2020-03-03T16:36:06.575Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.vcf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "4020cdc5-3d7e-4ce6-9aad-31f48b65a79a", + "fields": { + "created_date": "2020-03-03T16:36:06.830Z", + "modified_date": "2020-03-03T16:36:06.830Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "a4e6e929-352b-4846-a269-d54087920426", + "fields": { + "created_date": "2020-03-03T16:36:07.010Z", + "modified_date": "2020-03-03T16:36:07.010Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat.gz", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1c476759-813b-4347-aa9f-fa9682c2a944", + "fields": { + "created_date": "2020-03-03T16:36:05.711Z", + "modified_date": "2020-03-03T16:36:05.711Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.bam", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "99db2f04-d515-4b56-958d-a94156a3c0b0", + "fields": { + "created_date": "2020-03-03T16:36:05.741Z", + "modified_date": "2020-03-03T16:36:05.741Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads.bai", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.bai", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "4e7dabb9-d7e6-42d8-9465-38a458a569c3", + "fields": { + "created_date": "2020-03-03T16:36:05.770Z", + "modified_date": "2020-03-03T16:36:05.770Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.bam", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "53bae2b3-a71e-4224-9d7b-fa291d316192", + "fields": { + "created_date": "2020-03-03T16:36:05.798Z", + "modified_date": "2020-03-03T16:36:05.798Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.bai", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.bai", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "41d65651-7e58-4f87-9690-f1efe8925d3b", + "fields": { + "created_date": "2020-03-03T16:36:05.827Z", + "modified_date": "2020-03-03T16:36:05.827Z", + "file_name": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "22564e78-f3e1-4434-a048-b743624567ff", + "fields": { + "created_date": "2020-03-03T16:36:05.862Z", + "modified_date": "2020-03-03T16:36:05.862Z", + "file_name": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "f0f3c04d-3773-4c1c-aa42-cddb3ed5d49f", + "fields": { + "created_date": "2020-03-03T16:36:05.912Z", + "modified_date": "2020-03-03T16:36:05.912Z", + "file_name": "s_C_ALLANT_T001_d.rg.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md_metrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "0c0283e3-4407-4985-b44f-bcf28dab85ed", + "fields": { + "created_date": "2020-03-03T16:36:05.937Z", + "modified_date": "2020-03-03T16:36:05.937Z", + "file_name": "s_C_ALLANT_N002_d.rg.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md_metrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "f47bb433-b945-4e81-982f-13e6dae5d3c1", + "fields": { + "created_date": "2020-03-03T16:36:05.993Z", + "modified_date": "2020-03-03T16:36:05.993Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.asmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "fa8b9929-7533-45d6-81be-091ab96f1041", + "fields": { + "created_date": "2020-03-03T16:36:05.965Z", + "modified_date": "2020-03-03T16:36:05.965Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.asmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "4b1aa141-7efd-4836-8d96-2639218c29c9", + "fields": { + "created_date": "2020-03-03T16:36:06.084Z", + "modified_date": "2020-03-03T16:36:06.084Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.ismetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e9aab203-3487-41fb-a957-6b014c971297", + "fields": { + "created_date": "2020-03-03T16:36:06.063Z", + "modified_date": "2020-03-03T16:36:06.063Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.ismetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3df838af-02d4-4949-b582-5e114bfe224c", + "fields": { + "created_date": "2020-03-03T16:36:06.110Z", + "modified_date": "2020-03-03T16:36:06.110Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.ismetrics.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.ismetrics.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "9a860e59-3a48-40e9-b87d-9ac6bcc24463", + "fields": { + "created_date": "2020-03-03T16:36:06.137Z", + "modified_date": "2020-03-03T16:36:06.137Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.ismetrics.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.ismetrics.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "a5bae30f-0cf4-4fff-9ca3-fce7f21aafe8", + "fields": { + "created_date": "2020-03-03T16:36:06.193Z", + "modified_date": "2020-03-03T16:36:06.193Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.hstmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "7baa520c-4d32-4be2-8af8-52b82e00ac9c", + "fields": { + "created_date": "2020-03-03T16:36:06.164Z", + "modified_date": "2020-03-03T16:36:06.164Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.hstmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1443fcef-78eb-40eb-ab46-40b2214320c7", + "fields": { + "created_date": "2020-03-03T16:36:06.218Z", + "modified_date": "2020-03-03T16:36:06.218Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e96bb07e-b1d1-4a0f-803b-e92979450b14", + "fields": { + "created_date": "2020-03-03T16:36:06.238Z", + "modified_date": "2020-03-03T16:36:06.238Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "472bd390-fca8-404d-b55e-c610b1a2dcb6", + "fields": { + "created_date": "2020-03-03T16:36:06.262Z", + "modified_date": "2020-03-03T16:36:06.262Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "247fb744-857f-4c3e-a920-1fea2701fde1", + "fields": { + "created_date": "2020-03-03T16:36:06.287Z", + "modified_date": "2020-03-03T16:36:06.287Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "9a169250-e69b-483e-9dab-af304ea33df1", + "fields": { + "created_date": "2020-03-03T16:36:06.337Z", + "modified_date": "2020-03-03T16:36:06.337Z", + "file_name": "s_C_ALLANT_N002_d.rg.md_FP_base_counts.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md_FP_base_counts.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "2fba5e73-fe7f-4759-8c34-06fd86fa7885", + "fields": { + "created_date": "2020-03-03T16:36:06.314Z", + "modified_date": "2020-03-03T16:36:06.315Z", + "file_name": "s_C_ALLANT_T001_d.rg.md_FP_base_counts.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md_FP_base_counts.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "59fb9d8b-d738-40e8-9774-991702d5a4f7", + "fields": { + "created_date": "2020-03-03T16:36:06.417Z", + "modified_date": "2020-03-03T16:36:06.417Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.gcbiasmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "fb8faf59-e51f-48cd-883e-957f56fcd6d9", + "fields": { + "created_date": "2020-03-03T16:36:06.436Z", + "modified_date": "2020-03-03T16:36:06.436Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.gcbiasmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "a4457074-8ae2-4b85-8372-829b94ed43ec", + "fields": { + "created_date": "2020-03-03T16:36:06.488Z", + "modified_date": "2020-03-03T16:36:06.488Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.gcbias.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.gcbias.summary", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1b85855c-2a6e-4640-b43f-bd35bb7229a0", + "fields": { + "created_date": "2020-03-03T16:36:06.459Z", + "modified_date": "2020-03-03T16:36:06.459Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.gcbias.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.gcbias.summary", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "0d651786-9830-4e96-8b1d-df723def48c6", + "fields": { + "created_date": "2020-03-03T16:36:06.512Z", + "modified_date": "2020-03-03T16:36:06.512Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.pileup", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "6ed450c2-305c-4d6b-9799-3b9e4ffcf62e", + "fields": { + "created_date": "2020-03-03T16:36:06.530Z", + "modified_date": "2020-03-03T16:36:06.530Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.pileup", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "28f96b87-9542-48b3-a276-edfe8a3e3865", + "fields": { + "created_date": "2020-03-03T16:36:06.559Z", + "modified_date": "2020-03-03T16:36:06.559Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d6e63b33-18ae-4bd7-b6ff-9d53f67f20fd", + "fields": { + "created_date": "2020-03-03T16:36:06.595Z", + "modified_date": "2020-03-03T16:36:06.595Z", + "file_name": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "58432bc0-f1d3-4dae-a214-9ee1aeb8a3f5", + "fields": { + "created_date": "2020-03-03T16:36:06.621Z", + "modified_date": "2020-03-03T16:36:06.621Z", + "file_name": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz.tbi", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz.tbi", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "f2fc60bd-d341-4f0b-81fd-41e39f83d3eb", + "fields": { + "created_date": "2020-03-03T16:36:06.647Z", + "modified_date": "2020-03-03T16:36:06.647Z", + "file_name": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants.vcf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b16f3245-ec79-4a0a-a063-d63022b55b59", + "fields": { + "created_date": "2020-03-03T16:36:06.705Z", + "modified_date": "2020-03-03T16:36:06.705Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e9ad81bc-36fa-4ca4-924e-03217ac90f1e", + "fields": { + "created_date": "2020-03-03T16:36:06.674Z", + "modified_date": "2020-03-03T16:36:06.674Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "52670690-7584-4bbe-a742-b574e2906ee0", + "fields": { + "created_date": "2020-03-03T16:36:06.731Z", + "modified_date": "2020-03-03T16:36:06.731Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "88f63148-77ea-4168-b8d6-186029eeea1b", + "fields": { + "created_date": "2020-03-03T16:36:06.755Z", + "modified_date": "2020-03-03T16:36:06.755Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "c9ab61ad-c20e-443a-bbc2-b0667a8d2ad0", + "fields": { + "created_date": "2020-03-03T16:36:06.775Z", + "modified_date": "2020-03-03T16:36:06.775Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF.png", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "418838d1-4f3a-41b7-8625-95c333573a1d", + "fields": { + "created_date": "2020-03-03T16:36:06.801Z", + "modified_date": "2020-03-03T16:36:06.801Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF.png", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b4bdf448-5143-441a-a293-ca6406aa5570", + "fields": { + "created_date": "2020-03-03T16:36:06.851Z", + "modified_date": "2020-03-03T16:36:06.851Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d5e3ae2f-e324-4f7e-a273-e36962d4b264", + "fields": { + "created_date": "2020-03-03T16:36:06.901Z", + "modified_date": "2020-03-03T16:36:06.901Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.out", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "c44d24c7-d759-428a-8900-f5cefffe89aa", + "fields": { + "created_date": "2020-03-03T16:36:06.874Z", + "modified_date": "2020-03-03T16:36:06.874Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.out", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d029bc47-903b-49fb-b882-bc5c3c2a6f88", + "fields": { + "created_date": "2020-03-03T16:36:06.955Z", + "modified_date": "2020-03-03T16:36:06.955Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.Rdata", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "fd222279-2027-4b73-b6b3-4b6789104d7a", + "fields": { + "created_date": "2020-03-03T16:36:06.927Z", + "modified_date": "2020-03-03T16:36:06.927Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.Rdata", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d69772ec-1943-4902-9d7e-1937b0a038c7", + "fields": { + "created_date": "2020-03-03T16:36:06.977Z", + "modified_date": "2020-03-03T16:36:06.977Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.seg", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "fff9d989-b258-4d5a-8996-f985516baa06", + "fields": { + "created_date": "2020-03-03T16:36:06.994Z", + "modified_date": "2020-03-03T16:36:06.994Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.seg", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "8f768051-9e95-4334-b8ec-0b0e171dd9cc", + "fields": { + "created_date": "2020-03-03T16:36:07.028Z", + "modified_date": "2020-03-03T16:36:07.028Z", + "file_name": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/aa0694f1-0109-4205-a6b2-63e3e1d7c0a2/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts.maf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.filemetadata", + "pk": "b991aff4-b1c6-4eb7-9343-5ff5e1b90ad6", + "fields": { + "created_date": "2020-03-03T16:36:06.018Z", + "modified_date": "2020-03-03T16:36:06.018Z", + "file": "da37fe31-85ff-40e1-93a6-c279a6a54d7d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "916b9436-ab35-48fc-b71b-c4618a272961", + "fields": { + "created_date": "2020-03-03T16:36:06.044Z", + "modified_date": "2020-03-03T16:36:06.044Z", + "file": "d1e657e2-1342-4106-9ea3-8fea5da81a3e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b8d07803-2af0-40bd-8819-5b990d24ace0", + "fields": { + "created_date": "2020-03-03T16:36:06.395Z", + "modified_date": "2020-03-03T16:36:06.395Z", + "file": "333f2ff8-c1d1-4464-afd1-002ee6c26410", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "240fcb50-670c-4610-af18-3ba38599e568", + "fields": { + "created_date": "2020-03-03T16:36:06.366Z", + "modified_date": "2020-03-03T16:36:06.366Z", + "file": "634bc305-0109-42f3-ae73-7cb38c7b816d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c792539a-3abe-4d3d-a38f-22ae05632798", + "fields": { + "created_date": "2020-03-03T16:36:06.546Z", + "modified_date": "2020-03-03T16:36:06.546Z", + "file": "da766256-deac-48be-97ae-cf5691abbe21", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9801da2d-5c5e-48fd-8eff-bec031ffb72c", + "fields": { + "created_date": "2020-03-03T16:36:06.578Z", + "modified_date": "2020-03-03T16:36:06.578Z", + "file": "e009f03e-0db8-4432-979e-50c3faa1ffee", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3986996e-e8ab-4d69-a7a4-773370f89cab", + "fields": { + "created_date": "2020-03-03T16:36:06.832Z", + "modified_date": "2020-03-03T16:36:06.832Z", + "file": "4020cdc5-3d7e-4ce6-9aad-31f48b65a79a", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a1179af7-a90a-45d8-9262-e6d937944ecb", + "fields": { + "created_date": "2020-03-03T16:36:07.012Z", + "modified_date": "2020-03-03T16:36:07.012Z", + "file": "a4e6e929-352b-4846-a269-d54087920426", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fc719132-1d44-41ee-a9dc-c8984e0b5472", + "fields": { + "created_date": "2020-03-03T16:36:05.716Z", + "modified_date": "2020-03-03T16:36:05.716Z", + "file": "1c476759-813b-4347-aa9f-fa9682c2a944", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8b113534-e89e-4fc8-b8ff-7dc593226a91", + "fields": { + "created_date": "2020-03-03T16:36:05.746Z", + "modified_date": "2020-03-03T16:36:05.746Z", + "file": "99db2f04-d515-4b56-958d-a94156a3c0b0", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "77c356a0-4bcc-44ab-a92e-4c3bace760da", + "fields": { + "created_date": "2020-03-03T16:36:05.773Z", + "modified_date": "2020-03-03T16:36:05.774Z", + "file": "4e7dabb9-d7e6-42d8-9465-38a458a569c3", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "610f986c-506b-4b40-80a2-9959dcb35bc8", + "fields": { + "created_date": "2020-03-03T16:36:05.802Z", + "modified_date": "2020-03-03T16:36:05.802Z", + "file": "53bae2b3-a71e-4224-9d7b-fa291d316192", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "01785240-e916-4ab9-adf4-328288a20d0f", + "fields": { + "created_date": "2020-03-03T16:36:05.829Z", + "modified_date": "2020-03-03T16:36:05.829Z", + "file": "41d65651-7e58-4f87-9690-f1efe8925d3b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "cd450786-bc3f-4f9a-9f9c-ff8e16d79667", + "fields": { + "created_date": "2020-03-03T16:36:05.865Z", + "modified_date": "2020-03-03T16:36:05.865Z", + "file": "22564e78-f3e1-4434-a048-b743624567ff", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "76932260-f42a-46d9-bd30-9f16c24f8d87", + "fields": { + "created_date": "2020-03-03T16:36:05.915Z", + "modified_date": "2020-03-03T16:36:05.915Z", + "file": "f0f3c04d-3773-4c1c-aa42-cddb3ed5d49f", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "36abdaf4-15d5-4d9c-b7e2-ede4f7dd66fe", + "fields": { + "created_date": "2020-03-03T16:36:05.940Z", + "modified_date": "2020-03-03T16:36:05.940Z", + "file": "0c0283e3-4407-4985-b44f-bcf28dab85ed", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a06c4333-0a83-4c30-ace7-50a27acd7132", + "fields": { + "created_date": "2020-03-03T16:36:05.996Z", + "modified_date": "2020-03-03T16:36:05.996Z", + "file": "f47bb433-b945-4e81-982f-13e6dae5d3c1", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c6b32ae6-ae43-42f6-bfe0-c71dbf2c7689", + "fields": { + "created_date": "2020-03-03T16:36:05.967Z", + "modified_date": "2020-03-03T16:36:05.967Z", + "file": "fa8b9929-7533-45d6-81be-091ab96f1041", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "815803dd-2845-4ee3-aa3b-92f7c3ba80ed", + "fields": { + "created_date": "2020-03-03T16:36:06.087Z", + "modified_date": "2020-03-03T16:36:06.087Z", + "file": "4b1aa141-7efd-4836-8d96-2639218c29c9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "79dce444-8128-4df2-8f71-d85c0f5caa6e", + "fields": { + "created_date": "2020-03-03T16:36:06.066Z", + "modified_date": "2020-03-03T16:36:06.066Z", + "file": "e9aab203-3487-41fb-a957-6b014c971297", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "71d6f227-53d4-417a-b578-5db88a1fdeb6", + "fields": { + "created_date": "2020-03-03T16:36:06.114Z", + "modified_date": "2020-03-03T16:36:06.114Z", + "file": "3df838af-02d4-4949-b582-5e114bfe224c", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1166e5fd-9184-4376-800f-434735899316", + "fields": { + "created_date": "2020-03-03T16:36:06.140Z", + "modified_date": "2020-03-03T16:36:06.140Z", + "file": "9a860e59-3a48-40e9-b87d-9ac6bcc24463", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "936cdd5b-20e7-4b67-a968-05394d7a2cc1", + "fields": { + "created_date": "2020-03-03T16:36:06.197Z", + "modified_date": "2020-03-03T16:36:06.197Z", + "file": "a5bae30f-0cf4-4fff-9ca3-fce7f21aafe8", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "bca217f7-3cb6-419d-bb07-295de7700b6a", + "fields": { + "created_date": "2020-03-03T16:36:06.167Z", + "modified_date": "2020-03-03T16:36:06.167Z", + "file": "7baa520c-4d32-4be2-8af8-52b82e00ac9c", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "7668ef86-bf9f-4de6-b501-a2cc7612b491", + "fields": { + "created_date": "2020-03-03T16:36:06.220Z", + "modified_date": "2020-03-03T16:36:06.220Z", + "file": "1443fcef-78eb-40eb-ab46-40b2214320c7", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1b9943ed-41c1-4a89-a976-947c88731319", + "fields": { + "created_date": "2020-03-03T16:36:06.240Z", + "modified_date": "2020-03-03T16:36:06.240Z", + "file": "e96bb07e-b1d1-4a0f-803b-e92979450b14", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c8827690-182a-4a41-b4e2-591dca2dd562", + "fields": { + "created_date": "2020-03-03T16:36:06.265Z", + "modified_date": "2020-03-03T16:36:06.265Z", + "file": "472bd390-fca8-404d-b55e-c610b1a2dcb6", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d438c10e-5b46-4a6a-b223-42ff12eac67a", + "fields": { + "created_date": "2020-03-03T16:36:06.289Z", + "modified_date": "2020-03-03T16:36:06.289Z", + "file": "247fb744-857f-4c3e-a920-1fea2701fde1", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ef1d9d24-0eb1-4eef-b0ee-7c460accb67c", + "fields": { + "created_date": "2020-03-03T16:36:06.339Z", + "modified_date": "2020-03-03T16:36:06.339Z", + "file": "9a169250-e69b-483e-9dab-af304ea33df1", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "360cbd65-7ae6-4047-ae38-441062fd4f63", + "fields": { + "created_date": "2020-03-03T16:36:06.317Z", + "modified_date": "2020-03-03T16:36:06.317Z", + "file": "2fba5e73-fe7f-4759-8c34-06fd86fa7885", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8b15c2fb-a8b8-4963-a200-d36107fdef6e", + "fields": { + "created_date": "2020-03-03T16:36:06.418Z", + "modified_date": "2020-03-03T16:36:06.419Z", + "file": "59fb9d8b-d738-40e8-9774-991702d5a4f7", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8bb1c2bf-2218-4ea7-9fc7-4d39cafc1bf2", + "fields": { + "created_date": "2020-03-03T16:36:06.438Z", + "modified_date": "2020-03-03T16:36:06.438Z", + "file": "fb8faf59-e51f-48cd-883e-957f56fcd6d9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f139b284-32fc-4fdc-a741-a65c963c7bc3", + "fields": { + "created_date": "2020-03-03T16:36:06.492Z", + "modified_date": "2020-03-03T16:36:06.492Z", + "file": "a4457074-8ae2-4b85-8372-829b94ed43ec", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5d9df5cd-d350-4b35-bc0e-7145536eb4c2", + "fields": { + "created_date": "2020-03-03T16:36:06.463Z", + "modified_date": "2020-03-03T16:36:06.463Z", + "file": "1b85855c-2a6e-4640-b43f-bd35bb7229a0", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "206df3f1-d3c7-4f29-a510-c6d657e1bf8e", + "fields": { + "created_date": "2020-03-03T16:36:06.514Z", + "modified_date": "2020-03-03T16:36:06.514Z", + "file": "0d651786-9830-4e96-8b1d-df723def48c6", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "109da769-d9bd-413b-9a73-3c427fbe4568", + "fields": { + "created_date": "2020-03-03T16:36:06.531Z", + "modified_date": "2020-03-03T16:36:06.531Z", + "file": "6ed450c2-305c-4d6b-9799-3b9e4ffcf62e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b2aee98c-78c2-453b-9f01-ead0ec48cfa2", + "fields": { + "created_date": "2020-03-03T16:36:06.561Z", + "modified_date": "2020-03-03T16:36:06.561Z", + "file": "28f96b87-9542-48b3-a276-edfe8a3e3865", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6da46574-b871-4187-a2f8-77482e865448", + "fields": { + "created_date": "2020-03-03T16:36:06.598Z", + "modified_date": "2020-03-03T16:36:06.598Z", + "file": "d6e63b33-18ae-4bd7-b6ff-9d53f67f20fd", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8804537a-65bb-4138-9b59-1bab6f003881", + "fields": { + "created_date": "2020-03-03T16:36:06.623Z", + "modified_date": "2020-03-03T16:36:06.623Z", + "file": "58432bc0-f1d3-4dae-a214-9ee1aeb8a3f5", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0955437b-c2d0-4167-92c8-4345264cb919", + "fields": { + "created_date": "2020-03-03T16:36:06.650Z", + "modified_date": "2020-03-03T16:36:06.650Z", + "file": "f2fc60bd-d341-4f0b-81fd-41e39f83d3eb", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5584a86d-eb1e-41c0-817e-37089cd4918d", + "fields": { + "created_date": "2020-03-03T16:36:06.708Z", + "modified_date": "2020-03-03T16:36:06.708Z", + "file": "b16f3245-ec79-4a0a-a063-d63022b55b59", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "29256c2b-0718-4c59-a442-9a121e25e469", + "fields": { + "created_date": "2020-03-03T16:36:06.677Z", + "modified_date": "2020-03-03T16:36:06.677Z", + "file": "e9ad81bc-36fa-4ca4-924e-03217ac90f1e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d0ea2e68-752f-4047-b2b7-479bc8f7397f", + "fields": { + "created_date": "2020-03-03T16:36:06.734Z", + "modified_date": "2020-03-03T16:36:06.734Z", + "file": "52670690-7584-4bbe-a742-b574e2906ee0", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9e5b3d0b-9fe7-484c-a640-79ccbc0fa486", + "fields": { + "created_date": "2020-03-03T16:36:06.757Z", + "modified_date": "2020-03-03T16:36:06.757Z", + "file": "88f63148-77ea-4168-b8d6-186029eeea1b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "7bdedbcd-3453-4298-bad1-ed452703e5e5", + "fields": { + "created_date": "2020-03-03T16:36:06.778Z", + "modified_date": "2020-03-03T16:36:06.778Z", + "file": "c9ab61ad-c20e-443a-bbc2-b0667a8d2ad0", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "f65af55f-823d-44b2-99f8-de98eb0a4507", + "fields": { + "created_date": "2020-03-03T16:36:06.805Z", + "modified_date": "2020-03-03T16:36:06.805Z", + "file": "418838d1-4f3a-41b7-8625-95c333573a1d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3107c093-ddd2-4bcb-b41c-f42d4c81ba7a", + "fields": { + "created_date": "2020-03-03T16:36:06.854Z", + "modified_date": "2020-03-03T16:36:06.854Z", + "file": "b4bdf448-5143-441a-a293-ca6406aa5570", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b811ea8d-2850-40ca-b38d-218a536aa9bf", + "fields": { + "created_date": "2020-03-03T16:36:06.904Z", + "modified_date": "2020-03-03T16:36:06.904Z", + "file": "d5e3ae2f-e324-4f7e-a273-e36962d4b264", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6fb6dcf0-9789-4802-b66b-067f57657ba3", + "fields": { + "created_date": "2020-03-03T16:36:06.878Z", + "modified_date": "2020-03-03T16:36:06.878Z", + "file": "c44d24c7-d759-428a-8900-f5cefffe89aa", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c76d7f5c-359f-40fa-86c2-b06c5a08dd6c", + "fields": { + "created_date": "2020-03-03T16:36:06.959Z", + "modified_date": "2020-03-03T16:36:06.959Z", + "file": "d029bc47-903b-49fb-b882-bc5c3c2a6f88", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6d0bc211-c7c6-481f-8047-67bd9557fe54", + "fields": { + "created_date": "2020-03-03T16:36:06.930Z", + "modified_date": "2020-03-03T16:36:06.930Z", + "file": "fd222279-2027-4b73-b6b3-4b6789104d7a", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "91ca4bac-774d-43d0-811c-354a3c7c0fd1", + "fields": { + "created_date": "2020-03-03T16:36:06.979Z", + "modified_date": "2020-03-03T16:36:06.979Z", + "file": "d69772ec-1943-4902-9d7e-1937b0a038c7", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "cb1f6206-b746-4482-b365-15be34e1e88e", + "fields": { + "created_date": "2020-03-03T16:36:06.996Z", + "modified_date": "2020-03-03T16:36:06.996Z", + "file": "fff9d989-b258-4d5a-8996-f985516baa06", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "031f38ba-a48d-434c-ac16-86da92e68221", + "fields": { + "created_date": "2020-03-03T16:36:07.030Z", + "modified_date": "2020-03-03T16:36:07.030Z", + "file": "8f768051-9e95-4334-b8ec-0b0e171dd9cc", + "version": 0, + "metadata": {}, + "user": null + } + } +] diff --git a/fixtures/runs/dfefc47b-3ee4-4867-890f-9bab87c7f53f.run.json b/fixtures/runs/dfefc47b-3ee4-4867-890f-9bab87c7f53f.run.json new file mode 100644 index 000000000..b2439a3a1 --- /dev/null +++ b/fixtures/runs/dfefc47b-3ee4-4867-890f-9bab87c7f53f.run.json @@ -0,0 +1,6290 @@ +[ + { + "model": "runner.run", + "pk": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "fields": { + "created_date": "2020-03-03T15:53:43.824Z", + "modified_date": "2020-03-03T16:36:05.402Z", + "name": "ROSLIN ALN-REQ-ID, 1 of 1 (03/03/2020, 15:53:43)", + "app": "c7849f2b-9a4f-4352-acde-1d993af379d8", + "status": 4, + "execution_id": "59ffd3fd-2ea5-4d60-90d8-4e98c3684f23", + "job_statuses": {}, + "output_metadata": {}, + "tags": { + "requestId": "ALN-REQ-ID", + "labHeadName": "", + "labHeadEmail": "", + "sampleNameTumor": "s_C_ALLANT_T001_d", + "sampleNameNormal": "s_C_ALLANT_N002_d" + } + } + }, + { + "model": "runner.port", + "pk": "03d173f0-6234-4525-b65c-f53fda78e81f", + "fields": { + "created_date": "2020-03-03T15:53:48.089Z", + "modified_date": "2020-03-03T16:36:05.015Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "db_files", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "refseq": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "vep_data": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "vep_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "custom_enst": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_snps": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_vcf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "fp_genotypes": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "fp_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "hotspot_list": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "bait_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "hotspot_list_maf": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "target_intervals": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "conpair_markers_bed": { + "type": [ + "null", + "array" + ], + "items": "string" + } + } + }, + "secondary_files": [], + "db_value": { + "refseq": { + "class": "File", + "location": "bid://3814d1da-e507-4e7d-b65b-b4ae7e07ec61" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "class": "File", + "location": "bid://584079c8-13af-4816-9ad3-50ce86e13934" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "class": "File", + "location": "bid://3f2fcb1e-cdf4-4d71-8369-04197b5ef7ff" + }, + "fp_intervals": { + "class": "File", + "location": "bid://d058dd8e-6097-4556-b7e7-7c2184789036" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "class": "File", + "location": "bid://e0e6283e-24ba-466f-9ec6-b6d9d85b2acd" + }, + "bait_intervals": { + "class": "File", + "location": "bid://14b45ffc-8797-40dd-b456-669bf79c22bb" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "class": "File", + "location": "bid://92bff766-15fd-4316-8977-77afcef97dae" + }, + "target_intervals": { + "class": "File", + "location": "bid://dce51627-5764-429b-ba52-f9cab17d967d" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "value": { + "refseq": { + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.txt", + "class": "File" + }, + "vep_data": "/var/cache", + "vep_path": "/usr/bin/vep", + "custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", + "facets_snps": { + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "class": "File" + }, + "hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", + "fp_genotypes": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/FP_tiling_genotypes.txt", + "class": "File" + }, + "fp_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/FP_tiling_intervals.list", + "class": "File" + }, + "hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", + "delly_exclude": { + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.tsv", + "class": "File" + }, + "bait_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/picard_baits.interval_list", + "class": "File" + }, + "conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", + "hotspot_list_maf": { + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf", + "class": "File" + }, + "target_intervals": { + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/picard_targets.interval_list", + "class": "File" + }, + "conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed" + }, + "files": [ + "14b45ffc-8797-40dd-b456-669bf79c22bb", + "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "3f2fcb1e-cdf4-4d71-8369-04197b5ef7ff", + "584079c8-13af-4816-9ad3-50ce86e13934", + "92bff766-15fd-4316-8977-77afcef97dae", + "d058dd8e-6097-4556-b7e7-7c2184789036", + "dce51627-5764-429b-ba52-f9cab17d967d", + "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd" + ] + } + }, + { + "model": "runner.port", + "pk": "5a74c472-b4d0-4023-8959-af864698c3aa", + "fields": { + "created_date": "2020-03-03T15:53:48.105Z", + "modified_date": "2020-03-03T16:36:05.020Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "ref_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://96e3a791-2bc7-45f8-acc6-e519a29d5d0b" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta", + "class": "File" + }, + "files": [ + "96e3a791-2bc7-45f8-acc6-e519a29d5d0b" + ] + } + }, + { + "model": "runner.port", + "pk": "be55dace-c564-401b-a9b3-298da56a27a1", + "fields": { + "created_date": "2020-03-03T15:53:48.112Z", + "modified_date": "2020-03-03T16:36:05.024Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "mouse_fasta", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".amb", + ".ann", + ".bwt", + ".pac", + ".sa", + ".fai", + "^.dict" + ], + "db_value": { + "class": "File", + "location": "bid://b6b418fe-6c83-43a2-8bdc-f3af2b0954a7" + }, + "value": { + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta", + "class": "File" + }, + "files": [ + "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7" + ] + } + }, + { + "model": "runner.port", + "pk": "b8ece142-b7ed-4317-92f4-7b74d9fb2c58", + "fields": { + "created_date": "2020-03-03T15:53:48.117Z", + "modified_date": "2020-03-03T16:36:05.028Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "hapmap", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://87b6a57c-f15b-49eb-9d22-d3893d2e00ef" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf", + "class": "File" + }, + "files": [ + "87b6a57c-f15b-49eb-9d22-d3893d2e00ef" + ] + } + }, + { + "model": "runner.port", + "pk": "fc739da4-f2b8-4eab-b997-4ab8eccad025", + "fields": { + "created_date": "2020-03-03T15:53:48.124Z", + "modified_date": "2020-03-03T16:36:05.032Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "dbsnp", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://914dce04-bc41-427e-9b6c-3084bfa61250" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf", + "class": "File" + }, + "files": [ + "914dce04-bc41-427e-9b6c-3084bfa61250" + ] + } + }, + { + "model": "runner.port", + "pk": "b230ab7c-bbe7-42a0-9154-b3c72edd462a", + "fields": { + "created_date": "2020-03-03T15:53:48.130Z", + "modified_date": "2020-03-03T16:36:05.035Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "indels_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://c868b6e9-92bd-4855-9726-7945e4471973" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf", + "class": "File" + }, + "files": [ + "c868b6e9-92bd-4855-9726-7945e4471973" + ] + } + }, + { + "model": "runner.port", + "pk": "7fc24d2b-84b4-490e-acde-c02e4932d2fd", + "fields": { + "created_date": "2020-03-03T15:53:48.136Z", + "modified_date": "2020-03-03T16:36:05.039Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "snps_1000g", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://6f644f7f-a7b7-4573-a40a-6c5838f58b75" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf", + "class": "File" + }, + "files": [ + "6f644f7f-a7b7-4573-a40a-6c5838f58b75" + ] + } + }, + { + "model": "runner.port", + "pk": "e90e036c-6815-4bb4-879f-ded62ddcab0b", + "fields": { + "created_date": "2020-03-03T15:53:48.142Z", + "modified_date": "2020-03-03T16:36:05.042Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "cosmic", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".idx" + ], + "db_value": { + "class": "File", + "location": "bid://100204c9-c560-43d9-ab4d-8c03bc207f4e" + }, + "value": { + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "class": "File" + }, + "files": [ + "100204c9-c560-43d9-ab4d-8c03bc207f4e" + ] + } + }, + { + "model": "runner.port", + "pk": "549b3035-768b-45ad-9a66-382429216425", + "fields": { + "created_date": "2020-03-03T15:53:48.149Z", + "modified_date": "2020-03-03T16:36:05.046Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "exac_filter", + "port_type": 0, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "class": "File", + "location": "bid://5c1dfb8e-d831-43f1-892b-f3c0bf043ca2" + }, + "value": { + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "class": "File" + }, + "files": [ + "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2" + ] + } + }, + { + "model": "runner.port", + "pk": "cc9be866-6edc-4199-b015-fcc9fdc00d93", + "fields": { + "created_date": "2020-03-03T15:53:48.193Z", + "modified_date": "2020-03-03T16:36:05.082Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "runparams", + "port_type": 0, + "schema": { + "type": "record", + "fields": { + "pi": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "assay": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "genome": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "tmp_dir": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "pi_email": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "intervals": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "mutect_rf": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "complex_nn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "complex_tn": { + "type": [ + "null", + "array" + ], + "items": "float" + }, + "covariates": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "delly_type": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_cval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "mutect_dcov": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "num_threads": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "abra_ram_min": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "abra_scratch": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "facets_pcval": { + "type": [ + "null", + "array" + ], + "items": "int" + }, + "gatk_jar_path": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "project_prefix": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "opt_dup_pix_dist": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "emit_original_quals": { + "type": [ + "null", + "array" + ], + "items": "boolean" + }, + "num_cpu_threads_per_data_thread": { + "type": [ + "null", + "array" + ], + "items": "int" + } + } + }, + "secondary_files": [], + "db_value": { + "pi": "", + "assay": "IMPACT468_BAITS", + "genome": "GRCh37", + "tmp_dir": "/var/folders/0l/g_nl9gp57r57h3jvs9pznc9c2dx_pd/T/", + "pi_email": "", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.2, + "complex_tn": 0.5, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 50, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/var/folders/0l/g_nl9gp57r57h3jvs9pznc9c2dx_pd/T/", + "facets_pcval": 100, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": "ALN-REQ-ID", + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "value": { + "pi": "", + "assay": "IMPACT468_BAITS", + "genome": "GRCh37", + "tmp_dir": "/var/folders/0l/g_nl9gp57r57h3jvs9pznc9c2dx_pd/T/", + "pi_email": "", + "intervals": [ + "1", + "2", + "3", + "4", + "5", + "6", + "7", + "8", + "9", + "10", + "11", + "12", + "13", + "14", + "15", + "16", + "17", + "18", + "19", + "20", + "21", + "22", + "X", + "Y", + "MT" + ], + "mutect_rf": [ + "BadCigar" + ], + "complex_nn": 0.2, + "complex_tn": 0.5, + "covariates": [ + "CycleCovariate", + "ContextCovariate", + "ReadGroupCovariate", + "QualityScoreCovariate" + ], + "delly_type": [ + "DUP", + "DEL", + "INV", + "INS", + "BND" + ], + "facets_cval": 50, + "mutect_dcov": 50000, + "num_threads": 10, + "scripts_bin": "/usr/bin", + "abra_ram_min": 84000, + "abra_scratch": "/var/folders/0l/g_nl9gp57r57h3jvs9pznc9c2dx_pd/T/", + "facets_pcval": 100, + "gatk_jar_path": "/usr/bin/gatk.jar", + "project_prefix": "ALN-REQ-ID", + "opt_dup_pix_dist": "2500", + "emit_original_quals": true, + "num_cpu_threads_per_data_thread": 6 + }, + "files": [] + } + }, + { + "model": "runner.port", + "pk": "1f7cc0d7-272c-4a7d-8c9d-cf67f02d32be", + "fields": { + "created_date": "2020-03-03T15:53:48.198Z", + "modified_date": "2020-03-03T16:36:05.090Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "pair", + "port_type": 0, + "schema": { + "type": "array", + "items": "record" + }, + "secondary_files": [], + "db_value": [ + { + "CN": "MSKCC", + "ID": "s_C_ALLANT_T001_d", + "LB": "MyLibraryId", + "PL": "Illumina", + "PU": [ + "MyFlowCellId_MyBarcodeIndex" + ], + "R1": [ + { + "class": "File", + "location": "bid://450fc99c-c84f-4b4e-9a32-1e6ca6341cad" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://0edc3e64-6cfc-4f15-a3cb-6f90fdf01d15" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_ALLANT_T001_d_MyFlowCellId_MyBarcodeIndex" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_ALLANT_T001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_ALLANT_N002_d", + "LB": "MyLibraryId", + "PL": "Illumina", + "PU": [ + "MyFlowCellId_MyBarcodeIndex" + ], + "R1": [ + { + "class": "File", + "location": "bid://04f44221-a5d5-4b4c-84d4-92c8c8a4da5a" + } + ], + "R2": [ + { + "class": "File", + "location": "bid://b02c07f0-326a-44b4-9980-62954027f342" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_ALLANT_N002_d_MyFlowCellId_MyBarcodeIndex" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_ALLANT_N002_d.bam" + } + ], + "value": [ + { + "CN": "MSKCC", + "ID": "s_C_ALLANT_T001_d", + "LB": "MyLibraryId", + "PL": "Illumina", + "PU": [ + "MyFlowCellId_MyBarcodeIndex" + ], + "R1": [ + { + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz", + "class": "File" + } + ], + "R2": [ + { + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz", + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_ALLANT_T001_d_MyFlowCellId_MyBarcodeIndex" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_ALLANT_T001_d.bam" + }, + { + "CN": "MSKCC", + "ID": "s_C_ALLANT_N002_d", + "LB": "MyLibraryId", + "PL": "Illumina", + "PU": [ + "MyFlowCellId_MyBarcodeIndex" + ], + "R1": [ + { + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz", + "class": "File" + } + ], + "R2": [ + { + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz", + "class": "File" + } + ], + "bam": [], + "zR1": [], + "zR2": [], + "RG_ID": [ + "s_C_ALLANT_N002_d_MyFlowCellId_MyBarcodeIndex" + ], + "adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", + "adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", + "bwa_output": "s_C_ALLANT_N002_d.bam" + } + ], + "files": [ + "04f44221-a5d5-4b4c-84d4-92c8c8a4da5a", + "0edc3e64-6cfc-4f15-a3cb-6f90fdf01d15", + "450fc99c-c84f-4b4e-9a32-1e6ca6341cad", + "b02c07f0-326a-44b4-9980-62954027f342" + ] + } + }, + { + "model": "runner.port", + "pk": "78a4a544-e479-40cc-b1d1-88e869188c83", + "fields": { + "created_date": "2020-03-03T15:53:48.156Z", + "modified_date": "2020-03-03T16:36:05.078Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "curated_bams", + "port_type": 0, + "schema": { + "type": "array", + "items": [ + "null", + "array" + ] + }, + "secondary_files": [ + "^.bai" + ], + "db_value": [ + { + "class": "File", + "location": "bid://4af32904-03d2-4646-822d-8e520239421f" + }, + { + "class": "File", + "location": "bid://eaec3382-528f-4b6b-acff-b718c84a8980" + }, + { + "class": "File", + "location": "bid://e800d375-bd52-4829-9d37-18194d0e8824" + }, + { + "class": "File", + "location": "bid://f085a161-0f9e-4e7d-bef4-dce17f3cf311" + }, + { + "class": "File", + "location": "bid://9956c92d-395c-49bd-8806-93e94d66f91c" + }, + { + "class": "File", + "location": "bid://a4e02e9e-833e-4dfc-a8d8-caece136a2af" + }, + { + "class": "File", + "location": "bid://b6ae85ba-fd31-475a-b0fe-2a32789a4692" + }, + { + "class": "File", + "location": "bid://f4aeecab-b064-4935-a2af-014e633d5ef2" + }, + { + "class": "File", + "location": "bid://13b6946e-c047-49b8-bac3-34efddb0847d" + }, + { + "class": "File", + "location": "bid://7e7c92fd-1653-4de5-b0ad-fb1b35eafd95" + }, + { + "class": "File", + "location": "bid://7c918d29-514c-447b-81ee-8c7c36ee098c" + }, + { + "class": "File", + "location": "bid://312220bd-8bb6-41bd-817f-59217c364fdf" + }, + { + "class": "File", + "location": "bid://be0ed0ea-33f6-4331-9af9-6439f7b149d0" + }, + { + "class": "File", + "location": "bid://d959d541-f891-441d-9951-a6d1df49fb91" + }, + { + "class": "File", + "location": "bid://b75b9ba0-022c-4ec1-87f3-8c81d8b5d88b" + }, + { + "class": "File", + "location": "bid://acccd858-813d-46c3-85da-d7063f051f89" + }, + { + "class": "File", + "location": "bid://7a71c994-7c88-4523-8abd-ae50d792ba19" + }, + { + "class": "File", + "location": "bid://63fcfa9f-b2b1-446b-b1e5-0f58803fb2f4" + }, + { + "class": "File", + "location": "bid://54b4aef7-46f3-417b-949c-7d44d94b69df" + }, + { + "class": "File", + "location": "bid://d78b21a5-d156-4d96-b532-d7788872f292" + }, + { + "class": "File", + "location": "bid://8d2afc5f-7fc2-4584-a169-bd978314ae43" + }, + { + "class": "File", + "location": "bid://b4f708ff-8bea-47fc-8a4e-3ced60b817b1" + }, + { + "class": "File", + "location": "bid://fd08b546-720f-4622-b79d-693936d2b608" + }, + { + "class": "File", + "location": "bid://84c1c4a4-8ad9-4df8-a30d-fd5d9ec58cc7" + }, + { + "class": "File", + "location": "bid://938e0e74-bd4a-4d3f-b9e3-c327acad3f44" + }, + { + "class": "File", + "location": "bid://8e9b5b36-da56-4dc8-a895-0ff14a5457bc" + }, + { + "class": "File", + "location": "bid://c0298d8e-2dcf-487b-a1c5-888522a55abc" + }, + { + "class": "File", + "location": "bid://8a8dd9e3-1970-41d9-abfe-8d5f62745cbf" + }, + { + "class": "File", + "location": "bid://768c19d8-a4e6-4c14-86d9-8ac6fcd51798" + }, + { + "class": "File", + "location": "bid://87663bfc-8a6f-4c30-9528-85c4c9859abe" + }, + { + "class": "File", + "location": "bid://e339ee8d-4e73-4ca5-907a-eb8296c1cd18" + }, + { + "class": "File", + "location": "bid://ebbb6238-0bdb-4e28-9040-9e257ffb3407" + }, + { + "class": "File", + "location": "bid://0d184175-1f65-4af0-b67d-c93c7d50988a" + }, + { + "class": "File", + "location": "bid://29f16470-1721-4957-9fa4-c42a685e65e9" + }, + { + "class": "File", + "location": "bid://f70c128b-3466-4399-99d9-4bf33a5a53fe" + }, + { + "class": "File", + "location": "bid://62366951-1c94-4b75-82c6-384d5359cebe" + }, + { + "class": "File", + "location": "bid://c033a8df-2197-4e99-95ba-b47e5659621c" + }, + { + "class": "File", + "location": "bid://baa2b1ea-6954-4d48-87f6-017a1786b4eb" + }, + { + "class": "File", + "location": "bid://fee5555e-ca62-4213-ae2f-a86e45f1ab02" + }, + { + "class": "File", + "location": "bid://31f3fa2b-face-431d-ac31-5e4aa5c1f534" + } + ], + "value": [ + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006708_N001_d.Group9.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006709_N001_d.Group11.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006710_N001_d.Group5.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006711_N001_d.Group7.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006713_N001_d.Group10.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006714_N001_d.Group8.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006715_N001_d.Group6.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006716_N001_d.Group4.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006717_N001_d.Group3.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006718_N001_d.Group1.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_09TAFV_N001_d.Group20.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_1FPU8J_N001_d.Group10.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_29F7HE_N001_d.Group17.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_2J273K_N001_d.Group22.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_32WX55_N001_d.Group17.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_3WFCFP_N001_d.Group24.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_4XFY8V_N001_d.Group2.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_7XDAJW_N001_d.Group15.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_96X4FW_N001_d.Group13.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_A8N9WX_N001_d.Group12.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_CTR0E9_N001_d.Group25.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_DJE4C0_N001_d.Group8.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FDR1YC_N001_d.Group27.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FWK8C0_N001_d.Group8.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_HRE3UJ_N001_d.Group9.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JFM1K9_N001_d.Group3.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JWYL4J_N001_d.Group19.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_KAT85C_N001_d.Group15.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LC80PX_N001_d.Group7.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LNNV52_N001_d.Group26.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_MWF8PH_N001_d.Group6.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NJHH88_N001_d.Group16.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NR3W32_N001_d.Group21.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_P10A8A_N001_d.Group29.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U53DXH_N001_d.Group1.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U8A7CR_N001_d.Group14.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_VXC8TK_N001_d.Group24.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_W0TXP0_N001_d.Group22.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_WWTK32_N001_d.Group18.rg.md.abra.printreads.bam", + "class": "File" + }, + { + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_XXC7N6_N001_d.Group12.rg.md.abra.printreads.bam", + "class": "File" + } + ], + "files": [ + "0d184175-1f65-4af0-b67d-c93c7d50988a", + "13b6946e-c047-49b8-bac3-34efddb0847d", + "29f16470-1721-4957-9fa4-c42a685e65e9", + "312220bd-8bb6-41bd-817f-59217c364fdf", + "31f3fa2b-face-431d-ac31-5e4aa5c1f534", + "4af32904-03d2-4646-822d-8e520239421f", + "54b4aef7-46f3-417b-949c-7d44d94b69df", + "62366951-1c94-4b75-82c6-384d5359cebe", + "63fcfa9f-b2b1-446b-b1e5-0f58803fb2f4", + "768c19d8-a4e6-4c14-86d9-8ac6fcd51798", + "7a71c994-7c88-4523-8abd-ae50d792ba19", + "7c918d29-514c-447b-81ee-8c7c36ee098c", + "7e7c92fd-1653-4de5-b0ad-fb1b35eafd95", + "84c1c4a4-8ad9-4df8-a30d-fd5d9ec58cc7", + "87663bfc-8a6f-4c30-9528-85c4c9859abe", + "8a8dd9e3-1970-41d9-abfe-8d5f62745cbf", + "8d2afc5f-7fc2-4584-a169-bd978314ae43", + "8e9b5b36-da56-4dc8-a895-0ff14a5457bc", + "938e0e74-bd4a-4d3f-b9e3-c327acad3f44", + "9956c92d-395c-49bd-8806-93e94d66f91c", + "a4e02e9e-833e-4dfc-a8d8-caece136a2af", + "acccd858-813d-46c3-85da-d7063f051f89", + "b4f708ff-8bea-47fc-8a4e-3ced60b817b1", + "b6ae85ba-fd31-475a-b0fe-2a32789a4692", + "b75b9ba0-022c-4ec1-87f3-8c81d8b5d88b", + "baa2b1ea-6954-4d48-87f6-017a1786b4eb", + "be0ed0ea-33f6-4331-9af9-6439f7b149d0", + "c0298d8e-2dcf-487b-a1c5-888522a55abc", + "c033a8df-2197-4e99-95ba-b47e5659621c", + "d78b21a5-d156-4d96-b532-d7788872f292", + "d959d541-f891-441d-9951-a6d1df49fb91", + "e339ee8d-4e73-4ca5-907a-eb8296c1cd18", + "e800d375-bd52-4829-9d37-18194d0e8824", + "eaec3382-528f-4b6b-acff-b718c84a8980", + "ebbb6238-0bdb-4e28-9040-9e257ffb3407", + "f085a161-0f9e-4e7d-bef4-dce17f3cf311", + "f4aeecab-b064-4935-a2af-014e633d5ef2", + "f70c128b-3466-4399-99d9-4bf33a5a53fe", + "fd08b546-720f-4622-b79d-693936d2b608", + "fee5555e-ca62-4213-ae2f-a86e45f1ab02" + ] + } + }, + { + "model": "runner.port", + "pk": "b345ee69-f96d-4dd2-a269-0661c575bc65", + "fields": { + "created_date": "2020-03-03T15:53:48.237Z", + "modified_date": "2020-03-03T16:36:05.159Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "hs_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 4415, + "class": "File", + "location": "bid://3d2b178a-764a-4979-a6cb-6671fdba4028" + }, + { + "size": 4373, + "class": "File", + "location": "bid://8cbed193-0337-45e7-a2b8-b3f62e748960" + } + ], + "value": [ + { + "size": 4415, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.hsmetrics", + "checksum": "sha1$6eab07a933f863b60fe707a51eb1978874c8f716", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.hsmetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 4373, + "class": "File", + "nameext": ".hsmetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.hsmetrics", + "checksum": "sha1$425f717884e15e8a9b1018a6046ca07949b5d90b", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.hsmetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "3d2b178a-764a-4979-a6cb-6671fdba4028", + "8cbed193-0337-45e7-a2b8-b3f62e748960" + ] + } + }, + { + "model": "runner.port", + "pk": "09dfacfe-3f4a-4b0d-af9e-eaa0c20a6342", + "fields": { + "created_date": "2020-03-03T15:53:48.264Z", + "modified_date": "2020-03-03T16:36:05.228Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "gcbias_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 6768, + "class": "File", + "location": "bid://f3675a4e-bd28-478e-b9f1-276e6c3b0b82" + }, + { + "size": 6811, + "class": "File", + "location": "bid://1108be83-1004-4ed8-9252-6d876b2f3c05" + } + ], + "value": [ + { + "size": 6768, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_T001_d.rg.md.gcbias.pdf", + "checksum": "sha1$109cba6349098034f84d44bfecd0b4af227e249c", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.gcbias.pdf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.gcbias" + }, + { + "size": 6811, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_N002_d.rg.md.gcbias.pdf", + "checksum": "sha1$c34f2f71662827b8a0f49632630487fe276c2699", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.gcbias.pdf", + "nameroot": "s_C_ALLANT_N002_d.rg.md.gcbias" + } + ], + "files": [ + "1108be83-1004-4ed8-9252-6d876b2f3c05", + "f3675a4e-bd28-478e-b9f1-276e6c3b0b82" + ] + } + }, + { + "model": "runner.port", + "pk": "e3c470a2-4169-452e-875d-b32259fab9d2", + "fields": { + "created_date": "2020-03-03T15:53:48.279Z", + "modified_date": "2020-03-03T16:36:05.265Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "mutect_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 33881, + "class": "File", + "location": "bid://71e25233-77c1-414d-b762-c549b6b126dc" + }, + "value": { + "size": 33881, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.vcf", + "checksum": "sha1$933cbba8a0c401ab751a9b4ac025350636bd9bd1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.vcf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "71e25233-77c1-414d-b762-c549b6b126dc" + ] + } + }, + { + "model": "runner.port", + "pk": "67409d25-d5c7-4f87-9eae-12937e954224", + "fields": { + "created_date": "2020-03-03T15:53:48.287Z", + "modified_date": "2020-03-03T16:36:05.282Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "vardict_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 405145, + "class": "File", + "location": "bid://5c9ed739-c793-42bb-9608-f7d8dde43ea3" + }, + "value": { + "size": 405145, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.vcf", + "checksum": "sha1$fbab450a0662d8575a0e15cf6c1d0aea61755815", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.vcf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict" + }, + "files": [ + "5c9ed739-c793-42bb-9608-f7d8dde43ea3" + ] + } + }, + { + "model": "runner.port", + "pk": "ea79b56c-dff8-4d42-a834-f03e17116f8f", + "fields": { + "created_date": "2020-03-03T15:53:48.313Z", + "modified_date": "2020-03-03T16:36:05.330Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "facets_txt_hisens", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 568, + "class": "File", + "location": "bid://e50bd157-9e37-4efe-84e3-cbc3790e6373" + }, + "value": { + "size": 568, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf.txt", + "checksum": "sha1$1bc524c02bda27693e5528e2eb1f70e3c28b1cc7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf.txt", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf" + }, + "files": [ + "e50bd157-9e37-4efe-84e3-cbc3790e6373" + ] + } + }, + { + "model": "runner.port", + "pk": "2014fbd2-7b11-48d9-bba0-0e5e0b7dc596", + "fields": { + "created_date": "2020-03-03T15:53:48.334Z", + "modified_date": "2020-03-03T16:36:05.372Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "facets_counts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 80583, + "class": "File", + "location": "bid://191c19cb-39b7-447e-9d5b-13d755a9c5cb" + }, + "value": { + "size": 80583, + "class": "File", + "nameext": ".gz", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat.gz", + "checksum": "sha1$d0cbda7de6d84ce4c96dd2e8953c3840c4e40489", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat.gz", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat" + }, + "files": [ + "191c19cb-39b7-447e-9d5b-13d755a9c5cb" + ] + } + }, + { + "model": "runner.port", + "pk": "c46eed7d-4ee1-44ce-82a3-06780af08e80", + "fields": { + "created_date": "2020-03-03T15:53:48.342Z", + "modified_date": "2020-03-03T16:36:05.381Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "genome", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "GRCh37", + "value": "GRCh37", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "65c64504-2170-414d-9d31-0fa45f9b760a", + "fields": { + "created_date": "2020-03-03T15:53:48.346Z", + "modified_date": "2020-03-03T16:36:05.384Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "assay", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "IMPACT468_BAITS", + "value": "IMPACT468_BAITS", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "b42425b1-3cbf-468e-8dd7-cb1de1158c29", + "fields": { + "created_date": "2020-03-03T15:53:48.350Z", + "modified_date": "2020-03-03T16:36:05.387Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "pi", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "", + "value": "", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "d265d354-08e2-4702-9868-50149eef890e", + "fields": { + "created_date": "2020-03-03T15:53:48.354Z", + "modified_date": "2020-03-03T16:36:05.390Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "project_prefix", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "ALN-REQ-ID", + "value": "ALN-REQ-ID", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "55866f15-437e-48e9-9509-31ec98a5293f", + "fields": { + "created_date": "2020-03-03T15:53:48.358Z", + "modified_date": "2020-03-03T16:36:05.393Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "pi_email", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "", + "value": "", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "58cf2e69-f16f-40fb-b877-845221c52bdb", + "fields": { + "created_date": "2020-03-03T15:53:48.362Z", + "modified_date": "2020-03-03T16:36:05.396Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "normal_sample_name", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "s_C_ALLANT_N002_d", + "value": "s_C_ALLANT_N002_d", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "cd554f65-0c0b-4721-bec5-9d9a4381b81a", + "fields": { + "created_date": "2020-03-03T15:53:48.366Z", + "modified_date": "2020-03-03T16:36:05.398Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "tumor_sample_name", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "string" + }, + "secondary_files": [], + "db_value": "s_C_ALLANT_T001_d", + "value": "s_C_ALLANT_T001_d", + "files": [] + } + }, + { + "model": "runner.port", + "pk": "4bdecf98-8a63-4c5c-ae57-e87f921fbc47", + "fields": { + "created_date": "2020-03-03T15:53:48.210Z", + "modified_date": "2020-03-03T16:36:05.101Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "normal_bam", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + "^.bai" + ], + "db_value": { + "size": 37592971, + "class": "File", + "location": "bid://d4dc45ed-987f-44ad-ac86-cee06c5db9ae", + "secondaryFiles": [ + { + "size": 995248, + "class": "File", + "location": "bid://e0319335-fbc2-4084-a1aa-5dae313bdad6" + } + ] + }, + "value": { + "size": 37592971, + "class": "File", + "nameext": ".bam", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads.bam", + "checksum": "sha1$3147081231fcf6315fd023de8249afd0138ef519", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 995248, + "class": "File", + "nameext": ".bai", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads.bai", + "checksum": "sha1$9c85a3a9f1978cdd679b9d100709c60000171174", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads" + } + ] + }, + "files": [ + "d4dc45ed-987f-44ad-ac86-cee06c5db9ae", + "e0319335-fbc2-4084-a1aa-5dae313bdad6" + ] + } + }, + { + "model": "runner.port", + "pk": "0e2a8d57-4ea2-42ff-919c-aea2cd621688", + "fields": { + "created_date": "2020-03-03T15:53:48.216Z", + "modified_date": "2020-03-03T16:36:05.112Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "tumor_bam", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + "^.bai" + ], + "db_value": { + "size": 36055206, + "class": "File", + "location": "bid://1096779d-eea4-4501-9bb1-a320234590cd", + "secondaryFiles": [ + { + "size": 1526040, + "class": "File", + "location": "bid://10b6ae32-a39c-48ff-8a15-afcdb49cb586" + } + ] + }, + "value": { + "size": 36055206, + "class": "File", + "nameext": ".bam", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.bam", + "checksum": "sha1$2094e767b2fe1cede363fbd02281736ddc727bf0", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.bam", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads", + "secondaryFiles": [ + { + "size": 1526040, + "class": "File", + "nameext": ".bai", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.bai", + "checksum": "sha1$d2b24b7df3b65d248ffe499618646d4d943a8623", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.bai", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads" + } + ] + }, + "files": [ + "1096779d-eea4-4501-9bb1-a320234590cd", + "10b6ae32-a39c-48ff-8a15-afcdb49cb586" + ] + } + }, + { + "model": "runner.port", + "pk": "5760bcb8-fa80-4483-9fc7-b690ac21e6a6", + "fields": { + "created_date": "2020-03-03T15:53:48.222Z", + "modified_date": "2020-03-03T16:36:05.119Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "clstats1", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 1965, + "class": "File", + "location": "bid://83600fed-578a-4ab0-bc37-fc85a93cfaec" + } + ], + [ + { + "size": 1956, + "class": "File" + } + ] + ], + "value": [ + [ + { + "size": 1965, + "class": "File", + "nameext": ".stats", + "basename": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "checksum": "sha1$59a3708e76ab2a4dae029ecd0ea154296d725fd7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "nameroot": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl" + } + ], + [ + { + "size": 1956, + "class": "File", + "nameext": ".stats", + "basename": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "checksum": "sha1$9585d3eb8719e9298b210371bbde020b6d031d74", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "nameroot": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl" + } + ] + ], + "files": [ + "83600fed-578a-4ab0-bc37-fc85a93cfaec" + ] + } + }, + { + "model": "runner.port", + "pk": "398aa720-25fa-448b-ad1a-368fbd06b591", + "fields": { + "created_date": "2020-03-03T15:53:48.226Z", + "modified_date": "2020-03-03T16:36:05.128Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "clstats2", + "port_type": 1, + "schema": { + "type": "array", + "items": "array" + }, + "secondary_files": [], + "db_value": [ + [ + { + "size": 2170, + "class": "File", + "location": "bid://ae5143ce-aae5-40e7-a8dc-dc7709983b68" + } + ], + [ + { + "size": 2126, + "class": "File" + } + ] + ], + "value": [ + [ + { + "size": 2170, + "class": "File", + "nameext": ".stats", + "basename": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "checksum": "sha1$d03d360b63c6339a8d21926d9209b8b264d0e651", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "nameroot": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl" + } + ], + [ + { + "size": 2126, + "class": "File", + "nameext": ".stats", + "basename": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "checksum": "sha1$8562d2cd6ded34ae99d5d1955e4572164c396d4a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "nameroot": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl" + } + ] + ], + "files": [ + "ae5143ce-aae5-40e7-a8dc-dc7709983b68" + ] + } + }, + { + "model": "runner.port", + "pk": "15860f4e-1182-4397-9a18-abdb0db14da2", + "fields": { + "created_date": "2020-03-03T15:53:48.230Z", + "modified_date": "2020-03-03T16:36:05.137Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "md_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2761, + "class": "File", + "location": "bid://d42a1d40-5a3a-4cb6-8208-2737bdccc739" + }, + { + "size": 2834, + "class": "File", + "location": "bid://1e3b4ed9-d8ab-40de-b9b1-6ff3a18f0765" + } + ], + "value": [ + { + "size": 2761, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_ALLANT_T001_d.rg.md_metrics", + "checksum": "sha1$fe7a0deb837fb7973d2a7ae77c69f1d9b51a73f2", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md_metrics", + "nameroot": "s_C_ALLANT_T001_d.rg" + }, + { + "size": 2834, + "class": "File", + "nameext": ".md_metrics", + "basename": "s_C_ALLANT_N002_d.rg.md_metrics", + "checksum": "sha1$3c646d48843d6e0b2454a949c370c583e2279ca7", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md_metrics", + "nameroot": "s_C_ALLANT_N002_d.rg" + } + ], + "files": [ + "1e3b4ed9-d8ab-40de-b9b1-6ff3a18f0765", + "d42a1d40-5a3a-4cb6-8208-2737bdccc739" + ] + } + }, + { + "model": "runner.port", + "pk": "f203a657-ea18-4422-8c59-3fcd48c99508", + "fields": { + "created_date": "2020-03-03T15:53:48.233Z", + "modified_date": "2020-03-03T16:36:05.147Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "as_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 2075, + "class": "File", + "location": "bid://79dcaff4-4696-4aca-95ec-11d3b1437e04" + }, + { + "size": 2081, + "class": "File", + "location": "bid://3ceb6f23-b282-438b-a815-2389ed09d61c" + } + ], + "value": [ + { + "size": 2075, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.asmetrics", + "checksum": "sha1$2f0a157ca443d4b3df121db74a5935d9d47af978", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.asmetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 2081, + "class": "File", + "nameext": ".asmetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.asmetrics", + "checksum": "sha1$bd50324f8af6e7b25973211ad4bfc87ef4fa3e49", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.asmetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "3ceb6f23-b282-438b-a815-2389ed09d61c", + "79dcaff4-4696-4aca-95ec-11d3b1437e04" + ] + } + }, + { + "model": "runner.port", + "pk": "d1c20e83-2985-48fd-be8e-21b2895e1aaa", + "fields": { + "created_date": "2020-03-03T15:53:48.241Z", + "modified_date": "2020-03-03T16:36:05.170Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "insert_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 3602, + "class": "File", + "location": "bid://320966d6-8645-4962-89ef-9221468124a9" + }, + { + "size": 5243, + "class": "File", + "location": "bid://3acea0ac-b1c6-4aed-8457-28edba87aa18" + } + ], + "value": [ + { + "size": 3602, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.ismetrics", + "checksum": "sha1$c4fb277ff970130bdceda2f301d3361cd7ef4e8c", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.ismetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 5243, + "class": "File", + "nameext": ".ismetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.ismetrics", + "checksum": "sha1$4390f708f9a79fb1d6189f44e09b68d28227bdef", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.ismetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "320966d6-8645-4962-89ef-9221468124a9", + "3acea0ac-b1c6-4aed-8457-28edba87aa18" + ] + } + }, + { + "model": "runner.port", + "pk": "caa16902-3d0b-41b6-9bbe-d75164744e7a", + "fields": { + "created_date": "2020-03-03T15:53:48.244Z", + "modified_date": "2020-03-03T16:36:05.179Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "insert_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 9432, + "class": "File", + "location": "bid://5a77a927-821b-46cb-8d09-82e063959c04" + }, + { + "size": 12553, + "class": "File", + "location": "bid://07f90ced-b997-4380-b3ed-c81af7ca86c2" + } + ], + "value": [ + { + "size": 9432, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_T001_d.rg.md.ismetrics.pdf", + "checksum": "sha1$fff9666c3887a8e1e4ef871cc0e65bd7844b9cec", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.ismetrics" + }, + { + "size": 12553, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_N002_d.rg.md.ismetrics.pdf", + "checksum": "sha1$d65ee301077e716f463f012618e8d5f6aca80d54", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.ismetrics.pdf", + "nameroot": "s_C_ALLANT_N002_d.rg.md.ismetrics" + } + ], + "files": [ + "07f90ced-b997-4380-b3ed-c81af7ca86c2", + "5a77a927-821b-46cb-8d09-82e063959c04" + ] + } + }, + { + "model": "runner.port", + "pk": "b773bc0c-1843-42c6-8200-9bcad18d46cd", + "fields": { + "created_date": "2020-03-03T15:53:48.249Z", + "modified_date": "2020-03-03T16:36:05.189Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "per_target_coverage", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 380579, + "class": "File", + "location": "bid://c7518d11-7b1c-4253-81bc-241cf1a8fef8" + }, + { + "size": 381117, + "class": "File", + "location": "bid://5be5a463-f87f-433a-ac95-4344da5e20e6" + } + ], + "value": [ + { + "size": 380579, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.hstmetrics", + "checksum": "sha1$cb9ebd2583e8196e59f921275a9528e072f7f02a", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.hstmetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 381117, + "class": "File", + "nameext": ".hstmetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.hstmetrics", + "checksum": "sha1$60711c1d8999762cb51d261a77b94b1b788268a8", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.hstmetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "5be5a463-f87f-433a-ac95-4344da5e20e6", + "c7518d11-7b1c-4253-81bc-241cf1a8fef8" + ] + } + }, + { + "model": "runner.port", + "pk": "992af5a7-1fae-4117-920d-a2ede0da0434", + "fields": { + "created_date": "2020-03-03T15:53:48.252Z", + "modified_date": "2020-03-03T16:36:05.199Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "qual_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5441, + "class": "File", + "location": "bid://5dae2da0-b73e-4bf0-8299-f21995cf9b03" + }, + { + "size": 5444, + "class": "File", + "location": "bid://39dd73c7-48aa-4487-98bb-e9fcfbc76977" + } + ], + "value": [ + { + "size": 5441, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$522ae0536c87fdb89d66e15b01048d1487360772", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics" + }, + { + "size": 5444, + "class": "File", + "nameext": ".quality_by_cycle_metrics", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "checksum": "sha1$27aea791cdf511dc409175ab2695668eeb914c6e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics" + } + ], + "files": [ + "39dd73c7-48aa-4487-98bb-e9fcfbc76977", + "5dae2da0-b73e-4bf0-8299-f21995cf9b03" + ] + } + }, + { + "model": "runner.port", + "pk": "a0bb8eff-6aee-4f22-82b0-7ef8735b25c2", + "fields": { + "created_date": "2020-03-03T15:53:48.256Z", + "modified_date": "2020-03-03T16:36:05.209Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "qual_pdf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 8249, + "class": "File", + "location": "bid://9ebc97a4-604b-4724-954e-64dfd4e3b4f9" + }, + { + "size": 8311, + "class": "File", + "location": "bid://948b8c85-1393-4367-9747-bc787f5e16a4" + } + ], + "value": [ + { + "size": 8249, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$7de3bb4fae5aa67b4169968c0c9803944a11fd22", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + }, + { + "size": 8311, + "class": "File", + "nameext": ".pdf", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "checksum": "sha1$239ca199f678e8df125cf7344ff85666107d6ebf", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle" + } + ], + "files": [ + "948b8c85-1393-4367-9747-bc787f5e16a4", + "9ebc97a4-604b-4724-954e-64dfd4e3b4f9" + ] + } + }, + { + "model": "runner.port", + "pk": "26227fb9-7226-4fed-a696-2f51be3a0350", + "fields": { + "created_date": "2020-03-03T15:53:48.260Z", + "modified_date": "2020-03-03T16:36:05.217Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "doc_basecounts", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5173976, + "class": "File", + "location": "bid://30c777ce-5fa5-46fe-a572-931eeed1fa25" + }, + { + "size": 5177530, + "class": "File", + "location": "bid://91de3419-fd46-44b8-9510-58d0ddb46c0c" + } + ], + "value": [ + { + "size": 5173976, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_T001_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$cf649d08ef5c428c31e009b4ea296e62638b5280", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_ALLANT_T001_d.rg.md_FP_base_counts" + }, + { + "size": 5177530, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_N002_d.rg.md_FP_base_counts.txt", + "checksum": "sha1$4c56bce697b1cc4789125dd12501dd4aab8e456c", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md_FP_base_counts.txt", + "nameroot": "s_C_ALLANT_N002_d.rg.md_FP_base_counts" + } + ], + "files": [ + "30c777ce-5fa5-46fe-a572-931eeed1fa25", + "91de3419-fd46-44b8-9510-58d0ddb46c0c" + ] + } + }, + { + "model": "runner.port", + "pk": "59d020b2-7bbc-4e2d-8a60-4b205064da56", + "fields": { + "created_date": "2020-03-03T15:53:48.267Z", + "modified_date": "2020-03-03T16:36:05.238Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "gcbias_metrics", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 5981, + "class": "File", + "location": "bid://a6778005-a949-4213-ab71-64d7015be161" + }, + { + "size": 6017, + "class": "File", + "location": "bid://7777c19f-1114-4e1b-aba3-25b00836ae91" + } + ], + "value": [ + { + "size": 5981, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_ALLANT_T001_d.rg.md.gcbiasmetrics", + "checksum": "sha1$d8e35fc8003800808adfeb322a8ff45e4cf4d912", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 6017, + "class": "File", + "nameext": ".gcbiasmetrics", + "basename": "s_C_ALLANT_N002_d.rg.md.gcbiasmetrics", + "checksum": "sha1$89804e4b6c1b70e2f95468fd7539704a25e0cbd1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.gcbiasmetrics", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "7777c19f-1114-4e1b-aba3-25b00836ae91", + "a6778005-a949-4213-ab71-64d7015be161" + ] + } + }, + { + "model": "runner.port", + "pk": "b2e02316-a89c-4d4b-857b-5a40897cf56f", + "fields": { + "created_date": "2020-03-03T15:53:48.272Z", + "modified_date": "2020-03-03T16:36:05.246Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "gcbias_summary", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 1195, + "class": "File", + "location": "bid://a5f70008-97c5-411b-bdda-fb9a71158703" + }, + { + "size": 1194, + "class": "File", + "location": "bid://04afed1b-322e-454e-87cf-58fa84a7c60a" + } + ], + "value": [ + { + "size": 1195, + "class": "File", + "nameext": ".summary", + "basename": "s_C_ALLANT_T001_d.rg.md.gcbias.summary", + "checksum": "sha1$a3a44ab597276ae27a0edacf3edbc805861801ce", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.gcbias.summary", + "nameroot": "s_C_ALLANT_T001_d.rg.md.gcbias" + }, + { + "size": 1194, + "class": "File", + "nameext": ".summary", + "basename": "s_C_ALLANT_N002_d.rg.md.gcbias.summary", + "checksum": "sha1$307ad0c1c703c96a91c998ba83552a5a7c200d01", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.gcbias.summary", + "nameroot": "s_C_ALLANT_N002_d.rg.md.gcbias" + } + ], + "files": [ + "04afed1b-322e-454e-87cf-58fa84a7c60a", + "a5f70008-97c5-411b-bdda-fb9a71158703" + ] + } + }, + { + "model": "runner.port", + "pk": "02bad302-d766-41c2-a642-7bc69b3ebadb", + "fields": { + "created_date": "2020-03-03T15:53:48.275Z", + "modified_date": "2020-03-03T16:36:05.257Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "conpair_pileups", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 48680, + "class": "File", + "location": "bid://b867978b-8f7b-455a-aac6-7373de68b90b" + }, + { + "size": 92666, + "class": "File", + "location": "bid://1e8ae824-8a3a-46f8-9028-6efa69bda6c4" + } + ], + "value": [ + { + "size": 48680, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_ALLANT_T001_d.rg.md.pileup", + "checksum": "sha1$5130aba435a8c4a1038c5c6f057e2c83d1166563", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.pileup", + "nameroot": "s_C_ALLANT_T001_d.rg.md" + }, + { + "size": 92666, + "class": "File", + "nameext": ".pileup", + "basename": "s_C_ALLANT_N002_d.rg.md.pileup", + "checksum": "sha1$33be9aebd5b6cd314d2c223fe92cc4f6346d5fb8", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.pileup", + "nameroot": "s_C_ALLANT_N002_d.rg.md" + } + ], + "files": [ + "1e8ae824-8a3a-46f8-9028-6efa69bda6c4", + "b867978b-8f7b-455a-aac6-7373de68b90b" + ] + } + }, + { + "model": "runner.port", + "pk": "05ea5cde-cb8e-4e57-bbae-f9986a6ba7d4", + "fields": { + "created_date": "2020-03-03T15:53:48.283Z", + "modified_date": "2020-03-03T16:36:05.274Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "mutect_callstats", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 153557, + "class": "File", + "location": "bid://fa41aad5-abab-4c7d-ab95-76058ea1bcbc" + }, + "value": { + "size": 153557, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.txt", + "checksum": "sha1$c3da456c0a57a480c0aada1ded5444300407c797", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.txt", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect" + }, + "files": [ + "fa41aad5-abab-4c7d-ab95-76058ea1bcbc" + ] + } + }, + { + "model": "runner.port", + "pk": "bec6963a-2dc9-471f-b37f-e7ec0857091e", + "fields": { + "created_date": "2020-03-03T15:53:48.292Z", + "modified_date": "2020-03-03T16:36:05.291Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "combine_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 11194, + "class": "File", + "location": "bid://e4c3dc41-52b0-42fc-9e39-c90239818fec", + "secondaryFiles": [ + { + "size": 715, + "class": "File", + "location": "bid://41b63b20-488a-4e74-b981-cf7158507c17" + } + ] + }, + "value": { + "size": 11194, + "class": "File", + "nameext": ".gz", + "basename": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz", + "checksum": "sha1$ffeb151114c40103e60c909a5aa85fb09e4551cb", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz", + "nameroot": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf", + "secondaryFiles": [ + { + "size": 715, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz.tbi", + "checksum": "sha1$0c3fc05a167c66e4c1292633de489c0d31709b39", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz.tbi", + "nameroot": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz" + } + ] + }, + "files": [ + "41b63b20-488a-4e74-b981-cf7158507c17", + "e4c3dc41-52b0-42fc-9e39-c90239818fec" + ] + } + }, + { + "model": "runner.port", + "pk": "842f2de3-29a3-4d26-976b-501628c84e4d", + "fields": { + "created_date": "2020-03-03T15:53:48.296Z", + "modified_date": "2020-03-03T16:36:05.299Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "annotate_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 45215, + "class": "File", + "location": "bid://8acf0380-e6b6-4ead-ba7d-286eeb3ad539" + }, + "value": { + "size": 45215, + "class": "File", + "nameext": ".vcf", + "basename": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants.vcf", + "checksum": "sha1$e0eb5f7851dc08697a0bc4de526d0939ab07b658", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants.vcf", + "nameroot": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants" + }, + "files": [ + "8acf0380-e6b6-4ead-ba7d-286eeb3ad539" + ] + } + }, + { + "model": "runner.port", + "pk": "ceaaf87e-a3f1-44e3-b95e-30dce55a4ccc", + "fields": { + "created_date": "2020-03-03T15:53:48.300Z", + "modified_date": "2020-03-03T16:36:05.307Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "vardict_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 8488, + "class": "File", + "location": "bid://3d1ccfeb-512c-48dc-8b68-9c60c306d252", + "secondaryFiles": [ + { + "size": 716, + "class": "File", + "location": "bid://84fcec4d-f86d-486a-9596-69e04310848b" + } + ] + }, + "value": { + "size": 8488, + "class": "File", + "nameext": ".gz", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "checksum": "sha1$cd29808ed74e6e798cbc9d35c13625e2d4d49d9e", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 716, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$796cb4faf3c4914d19dfe3f81c83a9ef4fb34bb8", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "3d1ccfeb-512c-48dc-8b68-9c60c306d252", + "84fcec4d-f86d-486a-9596-69e04310848b" + ] + } + }, + { + "model": "runner.port", + "pk": "dfed542c-e5e5-438b-acf8-a211ce4a5a9b", + "fields": { + "created_date": "2020-03-03T15:53:48.304Z", + "modified_date": "2020-03-03T16:36:05.313Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "mutect_norm_vcf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [ + ".tbi" + ], + "db_value": { + "size": 3365, + "class": "File", + "location": "bid://d89c1c1c-3c06-48f6-b739-245456a02138", + "secondaryFiles": [ + { + "size": 174, + "class": "File", + "location": "bid://b6540a79-f539-4ee6-95ce-c5d5d12bd3bf" + } + ] + }, + "value": { + "size": 3365, + "class": "File", + "nameext": ".gz", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "checksum": "sha1$1ba440cbf249a6841543904f28d23c45d2832af6", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf", + "secondaryFiles": [ + { + "size": 174, + "class": "File", + "nameext": ".tbi", + "basename": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "checksum": "sha1$fcc4cd6d601fd39a662ecd0f07701ff882e29c35", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "nameroot": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz" + } + ] + }, + "files": [ + "b6540a79-f539-4ee6-95ce-c5d5d12bd3bf", + "d89c1c1c-3c06-48f6-b739-245456a02138" + ] + } + }, + { + "model": "runner.port", + "pk": "db1dafa2-41ad-4972-acd1-2e6a28997812", + "fields": { + "created_date": "2020-03-03T15:53:48.309Z", + "modified_date": "2020-03-03T16:36:05.322Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "facets_png", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 57706, + "class": "File", + "location": "bid://fb2118ff-5c2f-403d-b294-d4a646e7b763" + }, + { + "size": 55138, + "class": "File", + "location": "bid://7814d883-e5d0-4370-af69-2ce29ce4338d" + } + ], + "value": [ + { + "size": 57706, + "class": "File", + "nameext": ".png", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF.png", + "checksum": "sha1$049d66f6227b90ec362adcd9a548db3fc84e0103", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF.png", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF" + }, + { + "size": 55138, + "class": "File", + "nameext": ".png", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF.png", + "checksum": "sha1$66bc49f36660bf3612a9e14f42fc4b04aa671813", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF.png", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF" + } + ], + "files": [ + "7814d883-e5d0-4370-af69-2ce29ce4338d", + "fb2118ff-5c2f-403d-b294-d4a646e7b763" + ] + } + }, + { + "model": "runner.port", + "pk": "23e12160-4296-4edc-be85-29b6032cc162", + "fields": { + "created_date": "2020-03-03T15:53:48.317Z", + "modified_date": "2020-03-03T16:36:05.338Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "facets_txt_purity", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 272, + "class": "File", + "location": "bid://6d2972f4-62c1-4f62-b7da-f44475f19239" + }, + "value": { + "size": 272, + "class": "File", + "nameext": ".txt", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf.txt", + "checksum": "sha1$05d7689fd2d95572e54d1c87b033b150b555f4a1", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf.txt", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf" + }, + "files": [ + "6d2972f4-62c1-4f62-b7da-f44475f19239" + ] + } + }, + { + "model": "runner.port", + "pk": "0af68901-ee6c-447c-b073-5c47cf7030f4", + "fields": { + "created_date": "2020-03-03T15:53:48.322Z", + "modified_date": "2020-03-03T16:36:05.347Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "facets_out", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 580, + "class": "File", + "location": "bid://f4d6350f-4fd5-4eee-a56a-136d58682ebc" + }, + { + "size": 580, + "class": "File", + "location": "bid://7a3f1fce-0449-41c6-ac40-4678d45fec61" + } + ], + "value": [ + { + "size": 580, + "class": "File", + "nameext": ".out", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.out", + "checksum": "sha1$049ad328c87b935854addd937dee3235e1eda016", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.out", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 580, + "class": "File", + "nameext": ".out", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.out", + "checksum": "sha1$ed761951bdebb4213d1492fe4ceed5b23c77659f", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.out", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "7a3f1fce-0449-41c6-ac40-4678d45fec61", + "f4d6350f-4fd5-4eee-a56a-136d58682ebc" + ] + } + }, + { + "model": "runner.port", + "pk": "94c71e20-be50-4745-9640-7a7bf1d7167e", + "fields": { + "created_date": "2020-03-03T15:53:48.326Z", + "modified_date": "2020-03-03T16:36:05.356Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "facets_rdata", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 27113, + "class": "File", + "location": "bid://3f4fbe18-120b-4657-9be2-4023fa8f8394" + }, + { + "size": 27043, + "class": "File", + "location": "bid://3b8b7ab6-ab40-472d-b6b4-d8538d67be06" + } + ], + "value": [ + { + "size": 27113, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.Rdata", + "checksum": "sha1$674cc83029e73aecd3212049170aad144d006a33", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.Rdata", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 27043, + "class": "File", + "nameext": ".Rdata", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.Rdata", + "checksum": "sha1$20abe4b0bd0c25391f29b2fbf66bc228bc59814d", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.Rdata", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "3b8b7ab6-ab40-472d-b6b4-d8538d67be06", + "3f4fbe18-120b-4657-9be2-4023fa8f8394" + ] + } + }, + { + "model": "runner.port", + "pk": "c2f3b222-a0e5-4fdf-a1cc-3a89d7a84c1c", + "fields": { + "created_date": "2020-03-03T15:53:48.330Z", + "modified_date": "2020-03-03T16:36:05.365Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "facets_seg", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": [ + { + "size": 229, + "class": "File", + "location": "bid://1710c96e-24a6-4b7c-bb28-80c7ed8d0518" + }, + { + "size": 107, + "class": "File", + "location": "bid://3007708d-ab3b-45d9-a3f7-6bfcb7852b7b" + } + ], + "value": [ + { + "size": 229, + "class": "File", + "nameext": ".seg", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.seg", + "checksum": "sha1$2cd8276e43bb884232d8ac160046bfb2e052d51f", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.seg", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens" + }, + { + "size": 107, + "class": "File", + "nameext": ".seg", + "basename": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.seg", + "checksum": "sha1$db487a0aeb3d1cb191930125da911bd8580e2907", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.seg", + "nameroot": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity" + } + ], + "files": [ + "1710c96e-24a6-4b7c-bb28-80c7ed8d0518", + "3007708d-ab3b-45d9-a3f7-6bfcb7852b7b" + ] + } + }, + { + "model": "runner.port", + "pk": "ae8899ed-6e79-48e5-8af7-69eaa7e25ad1", + "fields": { + "created_date": "2020-03-03T15:53:48.338Z", + "modified_date": "2020-03-03T16:36:05.378Z", + "run": "dfefc47b-3ee4-4867-890f-9bab87c7f53f", + "name": "maf", + "port_type": 1, + "schema": { + "type": [ + "null", + "array" + ], + "items": "File" + }, + "secondary_files": [], + "db_value": { + "size": 105617, + "class": "File", + "location": "bid://959aa6f8-777b-435d-8cbe-0570c95e25b4" + }, + "value": { + "size": 105617, + "class": "File", + "nameext": ".maf", + "basename": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts.maf", + "checksum": "sha1$485415d59a040cd7296685452bd778b3f34f8147", + "location": "file:///juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts.maf", + "nameroot": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts" + }, + "files": [ + "959aa6f8-777b-435d-8cbe-0570c95e25b4" + ] + } + }, + { + "model": "file_system.file", + "pk": "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd", + "fields": { + "created_date": "2019-10-24T00:23:16.737Z", + "modified_date": "2019-10-24T00:23:16.737Z", + "file_name": "human.hg19.excl.tsv", + "path": "/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.tsv", + "file_type": 9, + "size": 6984, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "92bff766-15fd-4316-8977-77afcef97dae", + "fields": { + "created_date": "2019-12-09T23:31:22.151Z", + "modified_date": "2019-12-09T23:31:22.151Z", + "file_name": "hotspot-list-union-v1-v2.maf", + "path": "/juno/work/ci/resources/roslin-qc/hotspot-list-union-v1-v2.maf", + "file_type": 24, + "size": 624846, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "14b45ffc-8797-40dd-b456-669bf79c22bb", + "fields": { + "created_date": "2019-10-24T00:23:28.565Z", + "modified_date": "2019-10-24T00:23:28.565Z", + "file_name": "picard_baits.interval_list", + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/picard_baits.interval_list", + "file_type": 7, + "size": 332599, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "dce51627-5764-429b-ba52-f9cab17d967d", + "fields": { + "created_date": "2019-10-24T00:23:28.892Z", + "modified_date": "2019-10-24T00:23:28.892Z", + "file_name": "picard_targets.interval_list", + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/picard_targets.interval_list", + "file_type": 7, + "size": 198736, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "3f2fcb1e-cdf4-4d71-8369-04197b5ef7ff", + "fields": { + "created_date": "2019-10-24T00:23:27.976Z", + "modified_date": "2019-10-24T00:23:27.976Z", + "file_name": "FP_tiling_genotypes.txt", + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/FP_tiling_genotypes.txt", + "file_type": 10, + "size": 16088, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "fields": { + "created_date": "2019-10-24T00:23:15.075Z", + "modified_date": "2019-10-24T00:23:15.075Z", + "file_name": "refGene_b37.sorted.txt", + "path": "/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.txt", + "file_type": 10, + "size": 9953757, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "584079c8-13af-4816-9ad3-50ce86e13934", + "fields": { + "created_date": "2019-10-24T00:23:17.243Z", + "modified_date": "2019-10-24T00:23:17.243Z", + "file_name": "dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "path": "/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz", + "file_type": 11, + "size": 1015019014, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "d058dd8e-6097-4556-b7e7-7c2184789036", + "fields": { + "created_date": "2019-10-24T00:23:28.279Z", + "modified_date": "2019-10-24T00:23:28.279Z", + "file_name": "FP_tiling_intervals.list", + "path": "/juno/work/ci/resources/roslin_resources/targets/IMPACT468/b37/FP_tiling_intervals.list", + "file_type": 7, + "size": 21700, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "96e3a791-2bc7-45f8-acc6-e519a29d5d0b", + "fields": { + "created_date": "2019-12-06T20:05:01.506Z", + "modified_date": "2019-12-06T20:05:01.506Z", + "file_name": "b37.fasta", + "path": "/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta", + "file_type": 2, + "size": 3189750467, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7", + "fields": { + "created_date": "2019-10-24T00:23:19.218Z", + "modified_date": "2019-10-24T00:23:19.218Z", + "file_name": "GRCm38.fasta", + "path": "/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta", + "file_type": 2, + "size": 2769885087, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "87b6a57c-f15b-49eb-9d22-d3893d2e00ef", + "fields": { + "created_date": "2019-12-09T23:34:12.885Z", + "modified_date": "2019-12-09T23:34:12.886Z", + "file_name": "hapmap_3.3.b37.vcf", + "path": "/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf", + "file_type": 11, + "size": 225898391, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "914dce04-bc41-427e-9b6c-3084bfa61250", + "fields": { + "created_date": "2019-12-09T23:37:00.416Z", + "modified_date": "2019-12-09T23:37:00.416Z", + "file_name": "dbsnp_138.b37.excluding_sites_after_129.vcf", + "path": "/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf", + "file_type": 11, + "size": 2432705678, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c868b6e9-92bd-4855-9726-7945e4471973", + "fields": { + "created_date": "2019-12-10T15:40:05.224Z", + "modified_date": "2019-12-10T15:40:05.224Z", + "file_name": "Mills_and_1000G_gold_standard.indels.b37.vcf", + "path": "/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf", + "file_type": 11, + "size": 86369975, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "6f644f7f-a7b7-4573-a40a-6c5838f58b75", + "fields": { + "created_date": "2019-12-10T15:41:25.361Z", + "modified_date": "2019-12-10T15:41:25.361Z", + "file_name": "1000G_phase1.snps.high_confidence.b37.vcf", + "path": "/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf", + "file_type": 11, + "size": 7313069069, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "100204c9-c560-43d9-ab4d-8c03bc207f4e", + "fields": { + "created_date": "2019-12-10T15:41:47.402Z", + "modified_date": "2019-12-10T15:41:47.402Z", + "file_name": "CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "path": "/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.vcf", + "file_type": 11, + "size": 112402812, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2", + "fields": { + "created_date": "2019-12-10T15:42:27.587Z", + "modified_date": "2019-12-10T15:42:27.587Z", + "file_name": "ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "path": "/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz", + "file_type": 11, + "size": 337197976, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b02c07f0-326a-44b4-9980-62954027f342", + "fields": { + "created_date": "2020-01-14T21:19:56.882Z", + "modified_date": "2020-01-14T21:19:56.882Z", + "file_name": "DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz", + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz", + "file_type": 1, + "size": 9695259, + "file_group": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe" + } + }, + { + "model": "file_system.file", + "pk": "450fc99c-c84f-4b4e-9a32-1e6ca6341cad", + "fields": { + "created_date": "2020-01-14T21:19:57.252Z", + "modified_date": "2020-01-14T21:19:57.253Z", + "file_name": "DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz", + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz", + "file_type": 1, + "size": 8968582, + "file_group": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe" + } + }, + { + "model": "file_system.file", + "pk": "0edc3e64-6cfc-4f15-a3cb-6f90fdf01d15", + "fields": { + "created_date": "2020-01-14T21:19:57.591Z", + "modified_date": "2020-01-14T21:19:57.591Z", + "file_name": "DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz", + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz", + "file_type": 1, + "size": 8881738, + "file_group": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe" + } + }, + { + "model": "file_system.file", + "pk": "04f44221-a5d5-4b4c-84d4-92c8c8a4da5a", + "fields": { + "created_date": "2020-01-14T21:19:56.487Z", + "modified_date": "2020-01-14T21:19:56.487Z", + "file_name": "DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz", + "path": "/juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz", + "file_type": 1, + "size": 9446362, + "file_group": "0221fdb7-6cf8-41d7-9432-8cbbccfd08fe" + } + }, + { + "model": "file_system.file", + "pk": "62366951-1c94-4b75-82c6-384d5359cebe", + "fields": { + "created_date": "2019-10-24T00:23:51.267Z", + "modified_date": "2019-10-24T00:23:51.267Z", + "file_name": "s_C_U8A7CR_N001_d.Group14.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U8A7CR_N001_d.Group14.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2450372054, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e339ee8d-4e73-4ca5-907a-eb8296c1cd18", + "fields": { + "created_date": "2019-10-24T00:23:49.956Z", + "modified_date": "2019-10-24T00:23:49.956Z", + "file_name": "s_C_MWF8PH_N001_d.Group6.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_MWF8PH_N001_d.Group6.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2143139421, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "ebbb6238-0bdb-4e28-9040-9e257ffb3407", + "fields": { + "created_date": "2019-10-24T00:23:50.196Z", + "modified_date": "2019-10-24T00:23:50.196Z", + "file_name": "s_C_NJHH88_N001_d.Group16.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NJHH88_N001_d.Group16.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2613987166, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "7c918d29-514c-447b-81ee-8c7c36ee098c", + "fields": { + "created_date": "2019-10-24T00:23:44.904Z", + "modified_date": "2019-10-24T00:23:44.904Z", + "file_name": "s_C_09TAFV_N001_d.Group20.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_09TAFV_N001_d.Group20.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2298166927, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f70c128b-3466-4399-99d9-4bf33a5a53fe", + "fields": { + "created_date": "2019-10-24T00:23:51.016Z", + "modified_date": "2019-10-24T00:23:51.016Z", + "file_name": "s_C_U53DXH_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U53DXH_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2943821584, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8d2afc5f-7fc2-4584-a169-bd978314ae43", + "fields": { + "created_date": "2019-10-24T00:23:47.452Z", + "modified_date": "2019-10-24T00:23:47.452Z", + "file_name": "s_C_CTR0E9_N001_d.Group25.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_CTR0E9_N001_d.Group25.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1906184759, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "be0ed0ea-33f6-4331-9af9-6439f7b149d0", + "fields": { + "created_date": "2019-10-24T00:23:45.392Z", + "modified_date": "2019-10-24T00:23:45.392Z", + "file_name": "s_C_29F7HE_N001_d.Group17.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_29F7HE_N001_d.Group17.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1872524914, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "0d184175-1f65-4af0-b67d-c93c7d50988a", + "fields": { + "created_date": "2019-10-24T00:23:50.456Z", + "modified_date": "2019-10-24T00:23:50.456Z", + "file_name": "s_C_NR3W32_N001_d.Group21.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NR3W32_N001_d.Group21.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3185868859, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b6ae85ba-fd31-475a-b0fe-2a32789a4692", + "fields": { + "created_date": "2019-10-24T00:23:43.866Z", + "modified_date": "2019-10-24T00:23:43.866Z", + "file_name": "s_C_006715_N001_d.Group6.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006715_N001_d.Group6.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3817576500, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "eaec3382-528f-4b6b-acff-b718c84a8980", + "fields": { + "created_date": "2019-10-24T00:23:42.542Z", + "modified_date": "2019-10-24T00:23:42.542Z", + "file_name": "s_C_006709_N001_d.Group11.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006709_N001_d.Group11.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3506739569, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c033a8df-2197-4e99-95ba-b47e5659621c", + "fields": { + "created_date": "2019-10-24T00:23:51.511Z", + "modified_date": "2019-10-24T00:23:51.511Z", + "file_name": "s_C_VXC8TK_N001_d.Group24.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_VXC8TK_N001_d.Group24.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2842957613, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8e9b5b36-da56-4dc8-a895-0ff14a5457bc", + "fields": { + "created_date": "2019-10-24T00:23:48.746Z", + "modified_date": "2019-10-24T00:23:48.746Z", + "file_name": "s_C_JFM1K9_N001_d.Group3.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JFM1K9_N001_d.Group3.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1504713508, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "e800d375-bd52-4829-9d37-18194d0e8824", + "fields": { + "created_date": "2019-10-24T00:23:42.781Z", + "modified_date": "2019-10-24T00:23:42.781Z", + "file_name": "s_C_006710_N001_d.Group5.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006710_N001_d.Group5.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3554787689, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "84c1c4a4-8ad9-4df8-a30d-fd5d9ec58cc7", + "fields": { + "created_date": "2019-10-24T00:23:48.265Z", + "modified_date": "2019-10-24T00:23:48.265Z", + "file_name": "s_C_FWK8C0_N001_d.Group8.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FWK8C0_N001_d.Group8.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2337197309, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "9956c92d-395c-49bd-8806-93e94d66f91c", + "fields": { + "created_date": "2019-10-24T00:23:43.368Z", + "modified_date": "2019-10-24T00:23:43.368Z", + "file_name": "s_C_006713_N001_d.Group10.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006713_N001_d.Group10.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 357147001, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "8a8dd9e3-1970-41d9-abfe-8d5f62745cbf", + "fields": { + "created_date": "2019-10-24T00:23:49.232Z", + "modified_date": "2019-10-24T00:23:49.232Z", + "file_name": "s_C_KAT85C_N001_d.Group15.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_KAT85C_N001_d.Group15.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2332122557, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "29f16470-1721-4957-9fa4-c42a685e65e9", + "fields": { + "created_date": "2019-10-24T00:23:50.696Z", + "modified_date": "2019-10-24T00:23:50.696Z", + "file_name": "s_C_P10A8A_N001_d.Group29.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_P10A8A_N001_d.Group29.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1893685916, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "31f3fa2b-face-431d-ac31-5e4aa5c1f534", + "fields": { + "created_date": "2019-10-24T00:23:52.309Z", + "modified_date": "2019-10-24T00:23:52.309Z", + "file_name": "s_C_XXC7N6_N001_d.Group12.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_XXC7N6_N001_d.Group12.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2076693674, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "d959d541-f891-441d-9951-a6d1df49fb91", + "fields": { + "created_date": "2019-10-24T00:23:45.638Z", + "modified_date": "2019-10-24T00:23:45.638Z", + "file_name": "s_C_2J273K_N001_d.Group22.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_2J273K_N001_d.Group22.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2587901961, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f085a161-0f9e-4e7d-bef4-dce17f3cf311", + "fields": { + "created_date": "2019-10-24T00:23:43.018Z", + "modified_date": "2019-10-24T00:23:43.018Z", + "file_name": "s_C_006711_N001_d.Group7.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006711_N001_d.Group7.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 4384120977, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "a4e02e9e-833e-4dfc-a8d8-caece136a2af", + "fields": { + "created_date": "2019-10-24T00:23:43.629Z", + "modified_date": "2019-10-24T00:23:43.629Z", + "file_name": "s_C_006714_N001_d.Group8.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006714_N001_d.Group8.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1685774338, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b4f708ff-8bea-47fc-8a4e-3ced60b817b1", + "fields": { + "created_date": "2019-10-24T00:23:47.702Z", + "modified_date": "2019-10-24T00:23:47.702Z", + "file_name": "s_C_DJE4C0_N001_d.Group8.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_DJE4C0_N001_d.Group8.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2049846455, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "b75b9ba0-022c-4ec1-87f3-8c81d8b5d88b", + "fields": { + "created_date": "2019-10-24T00:23:45.879Z", + "modified_date": "2019-10-24T00:23:45.879Z", + "file_name": "s_C_32WX55_N001_d.Group17.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_32WX55_N001_d.Group17.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2054678576, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "13b6946e-c047-49b8-bac3-34efddb0847d", + "fields": { + "created_date": "2019-10-24T00:23:44.400Z", + "modified_date": "2019-10-24T00:23:44.400Z", + "file_name": "s_C_006717_N001_d.Group3.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006717_N001_d.Group3.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1873938178, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "c0298d8e-2dcf-487b-a1c5-888522a55abc", + "fields": { + "created_date": "2019-10-24T00:23:48.989Z", + "modified_date": "2019-10-24T00:23:48.989Z", + "file_name": "s_C_JWYL4J_N001_d.Group19.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JWYL4J_N001_d.Group19.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2324784125, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "acccd858-813d-46c3-85da-d7063f051f89", + "fields": { + "created_date": "2019-10-24T00:23:46.115Z", + "modified_date": "2019-10-24T00:23:46.115Z", + "file_name": "s_C_3WFCFP_N001_d.Group24.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_3WFCFP_N001_d.Group24.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1507048799, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "54b4aef7-46f3-417b-949c-7d44d94b69df", + "fields": { + "created_date": "2019-10-24T00:23:46.903Z", + "modified_date": "2019-10-24T00:23:46.903Z", + "file_name": "s_C_96X4FW_N001_d.Group13.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_96X4FW_N001_d.Group13.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2972235408, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "7a71c994-7c88-4523-8abd-ae50d792ba19", + "fields": { + "created_date": "2019-10-24T00:23:46.359Z", + "modified_date": "2019-10-24T00:23:46.359Z", + "file_name": "s_C_4XFY8V_N001_d.Group2.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_4XFY8V_N001_d.Group2.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1702329989, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "312220bd-8bb6-41bd-817f-59217c364fdf", + "fields": { + "created_date": "2019-10-24T00:23:45.151Z", + "modified_date": "2019-10-24T00:23:45.151Z", + "file_name": "s_C_1FPU8J_N001_d.Group10.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_1FPU8J_N001_d.Group10.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1281116533, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "768c19d8-a4e6-4c14-86d9-8ac6fcd51798", + "fields": { + "created_date": "2019-10-24T00:23:49.472Z", + "modified_date": "2019-10-24T00:23:49.472Z", + "file_name": "s_C_LC80PX_N001_d.Group7.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LC80PX_N001_d.Group7.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2999188032, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "f4aeecab-b064-4935-a2af-014e633d5ef2", + "fields": { + "created_date": "2019-10-24T00:23:44.108Z", + "modified_date": "2019-10-24T00:23:44.108Z", + "file_name": "s_C_006716_N001_d.Group4.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006716_N001_d.Group4.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3542807384, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "fd08b546-720f-4622-b79d-693936d2b608", + "fields": { + "created_date": "2019-10-24T00:23:48.002Z", + "modified_date": "2019-10-24T00:23:48.002Z", + "file_name": "s_C_FDR1YC_N001_d.Group27.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FDR1YC_N001_d.Group27.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1438785234, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "baa2b1ea-6954-4d48-87f6-017a1786b4eb", + "fields": { + "created_date": "2019-10-24T00:23:51.753Z", + "modified_date": "2019-10-24T00:23:51.753Z", + "file_name": "s_C_W0TXP0_N001_d.Group22.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_W0TXP0_N001_d.Group22.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1841725480, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "fee5555e-ca62-4213-ae2f-a86e45f1ab02", + "fields": { + "created_date": "2019-10-24T00:23:52.057Z", + "modified_date": "2019-10-24T00:23:52.057Z", + "file_name": "s_C_WWTK32_N001_d.Group18.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_WWTK32_N001_d.Group18.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1677939673, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "7e7c92fd-1653-4de5-b0ad-fb1b35eafd95", + "fields": { + "created_date": "2019-10-24T00:23:44.656Z", + "modified_date": "2019-10-24T00:23:44.656Z", + "file_name": "s_C_006718_N001_d.Group1.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006718_N001_d.Group1.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 4023855606, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "87663bfc-8a6f-4c30-9528-85c4c9859abe", + "fields": { + "created_date": "2019-10-24T00:23:49.716Z", + "modified_date": "2019-10-24T00:23:49.716Z", + "file_name": "s_C_LNNV52_N001_d.Group26.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LNNV52_N001_d.Group26.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2013280397, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "4af32904-03d2-4646-822d-8e520239421f", + "fields": { + "created_date": "2019-10-24T00:23:42.302Z", + "modified_date": "2019-10-24T00:23:42.302Z", + "file_name": "s_C_006708_N001_d.Group9.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006708_N001_d.Group9.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 3727525387, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "938e0e74-bd4a-4d3f-b9e3-c327acad3f44", + "fields": { + "created_date": "2019-10-24T00:23:48.506Z", + "modified_date": "2019-10-24T00:23:48.506Z", + "file_name": "s_C_HRE3UJ_N001_d.Group9.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_HRE3UJ_N001_d.Group9.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1179733581, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "63fcfa9f-b2b1-446b-b1e5-0f58803fb2f4", + "fields": { + "created_date": "2019-10-24T00:23:46.665Z", + "modified_date": "2019-10-24T00:23:46.665Z", + "file_name": "s_C_7XDAJW_N001_d.Group15.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_7XDAJW_N001_d.Group15.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 1837781380, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.file", + "pk": "d78b21a5-d156-4d96-b532-d7788872f292", + "fields": { + "created_date": "2019-10-24T00:23:47.142Z", + "modified_date": "2019-10-24T00:23:47.142Z", + "file_name": "s_C_A8N9WX_N001_d.Group12.rg.md.abra.printreads.bam", + "path": "/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_A8N9WX_N001_d.Group12.rg.md.abra.printreads.bam", + "file_type": 3, + "size": 2093758629, + "file_group": "4616ef88-103c-4cf4-baab-f3a247bc2172" + } + }, + { + "model": "file_system.filemetadata", + "pk": "c572a28f-c8a7-4fae-b6a5-b1de88f49eda", + "fields": { + "created_date": "2019-10-24T00:23:16.747Z", + "modified_date": "2019-10-24T00:23:16.747Z", + "file": "e0e6283e-24ba-466f-9ec6-b6d9d85b2acd", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "delly" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d82d6bf2-1014-47b5-9475-95ad04a3c729", + "fields": { + "created_date": "2019-12-09T23:31:22.187Z", + "modified_date": "2019-12-09T23:31:22.187Z", + "file": "92bff766-15fd-4316-8977-77afcef97dae", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "05313201-3be2-4fdf-ad3f-65bc4ce331c6", + "fields": { + "created_date": "2019-10-24T00:23:28.575Z", + "modified_date": "2019-10-24T00:23:28.575Z", + "file": "14b45ffc-8797-40dd-b456-669bf79c22bb", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "baits_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "bdbfb99d-dcda-4983-b6bc-64580913e7aa", + "fields": { + "created_date": "2019-10-24T00:23:28.902Z", + "modified_date": "2019-10-24T00:23:28.902Z", + "file": "dce51627-5764-429b-ba52-f9cab17d967d", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "targets_list" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "505c7e2e-20b1-4eef-8ed2-759d0247cd77", + "fields": { + "created_date": "2019-10-24T00:23:27.986Z", + "modified_date": "2019-10-24T00:23:27.987Z", + "file": "3f2fcb1e-cdf4-4d71-8369-04197b5ef7ff", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "FP_genotypes" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "10454e5e-9a20-4beb-af95-fcf2d856ecaf", + "fields": { + "created_date": "2019-10-24T00:23:15.094Z", + "modified_date": "2019-10-24T00:23:15.094Z", + "file": "3814d1da-e507-4e7d-b65b-b4ae7e07ec61", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "refseq" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d386a959-9036-4eaf-8793-4ee7aaff0c07", + "fields": { + "created_date": "2019-10-24T00:23:17.253Z", + "modified_date": "2019-10-24T00:23:17.253Z", + "file": "584079c8-13af-4816-9ad3-50ce86e13934", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "facets_snps" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b3534d26-d612-4fdc-bf12-ee0eba236db8", + "fields": { + "created_date": "2019-10-24T00:23:28.289Z", + "modified_date": "2019-10-24T00:23:28.289Z", + "file": "d058dd8e-6097-4556-b7e7-7c2184789036", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "FP_intervals" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "61a79866-b376-47e4-9d2e-f48ba2db7eba", + "fields": { + "created_date": "2019-12-06T20:05:01.781Z", + "modified_date": "2019-12-06T20:05:01.781Z", + "file": "96e3a791-2bc7-45f8-acc6-e519a29d5d0b", + "version": 0, + "metadata": { + "genome": "GRCh37", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2257c5e7-356a-422e-b409-ecddac244f00", + "fields": { + "created_date": "2019-10-24T00:23:19.228Z", + "modified_date": "2019-10-24T00:23:19.228Z", + "file": "b6b418fe-6c83-43a2-8bdc-f3af2b0954a7", + "version": 0, + "metadata": { + "genome": "GRCh38", + "data_type": "fasta" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "25dc1fa1-b0d5-4924-9ccb-bb18ec59f4ac", + "fields": { + "created_date": "2019-12-09T23:34:12.902Z", + "modified_date": "2019-12-09T23:34:12.902Z", + "file": "87b6a57c-f15b-49eb-9d22-d3893d2e00ef", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ad10ee7-c875-46cb-9a69-57acd461cf41", + "fields": { + "created_date": "2019-12-09T23:37:00.429Z", + "modified_date": "2019-12-09T23:37:00.429Z", + "file": "914dce04-bc41-427e-9b6c-3084bfa61250", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ae8c6fe5-f9e3-4650-9f09-8906342e4783", + "fields": { + "created_date": "2019-12-10T15:40:05.251Z", + "modified_date": "2019-12-10T15:40:05.251Z", + "file": "c868b6e9-92bd-4855-9726-7945e4471973", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "abfd67dc-9139-4165-aa46-de34de1903d6", + "fields": { + "created_date": "2019-12-10T15:41:25.375Z", + "modified_date": "2019-12-10T15:41:25.375Z", + "file": "6f644f7f-a7b7-4573-a40a-6c5838f58b75", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "de7089b7-8a69-4948-b601-5b965e4e9dae", + "fields": { + "created_date": "2019-12-10T15:41:47.412Z", + "modified_date": "2019-12-10T15:41:47.412Z", + "file": "100204c9-c560-43d9-ab4d-8c03bc207f4e", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "300442b0-9009-4d2c-9dc1-c226a7c09ee8", + "fields": { + "created_date": "2019-12-10T15:42:27.601Z", + "modified_date": "2019-12-10T15:42:27.601Z", + "file": "5c1dfb8e-d831-43f1-892b-f3c0bf043ca2", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a011d87a-fad3-405c-bed8-e8ef26ce5b16", + "fields": { + "created_date": "2020-01-14T21:19:56.908Z", + "modified_date": "2020-01-14T21:19:56.908Z", + "file": "b02c07f0-326a-44b4-9980-62954027f342", + "version": 0, + "metadata": { + "R": "R2", + "sex": "Unknown", + "runId": null, + "recipe": "CustomCapture", + "baitSet": "IMPACT468_BAITS", + "piEmail": "", + "runDate": null, + "runMode": null, + "species": "Human", + "platform": "MySequencingPlatform", + "sampleId": "ALN-TEST-02", + "barcodeId": null, + "libraryId": "MyLibraryId", + "patientId": "C-ALLANT", + "requestId": "ALN-REQ-ID", + "flowCellId": "MyFlowCellId", + "readLength": null, + "sampleName": "C-ALLANT-N002-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "", + "sampleClass": "Normal", + "barcodeIndex": "MyBarcodeIndex", + "labHeadEmail": "", + "oncoTreeCode": null, + "preservation": "FFPE", + "sampleOrigin": "Cells", + "specimenType": "Blood", + "flowCellLanes": [], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "ALN_TEST_EXT_02", + "investigatorName": "", + "sequencingCenter": "MySequencingCenter", + "investigatorEmail": "", + "projectManagerName": "", + "investigatorSampleId": "ALN", + "captureConcentrationNm": null, + "libraryConcentrationNgul": null + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6cfdf466-7d3e-45b2-804b-b1c09593b611", + "fields": { + "created_date": "2020-01-14T21:19:57.261Z", + "modified_date": "2020-01-14T21:19:57.261Z", + "file": "450fc99c-c84f-4b4e-9a32-1e6ca6341cad", + "version": 0, + "metadata": { + "R": "R1", + "sex": "Unknown", + "runId": null, + "recipe": "CustomCapture", + "baitSet": "IMPACT468_BAITS", + "piEmail": "", + "runDate": null, + "runMode": null, + "species": "Human", + "platform": "MySequencingPlatform", + "sampleId": "ALN-TEST-01", + "barcodeId": null, + "libraryId": "MyLibraryId", + "patientId": "C-ALLANT", + "requestId": "ALN-REQ-ID", + "flowCellId": "MyFlowCellId", + "readLength": null, + "sampleName": "C-ALLANT-T001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "", + "sampleClass": "Tumor", + "barcodeIndex": "MyBarcodeIndex", + "labHeadEmail": "", + "oncoTreeCode": null, + "preservation": "FFPE", + "sampleOrigin": "Cells", + "specimenType": "Blood", + "flowCellLanes": [], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "ALN_TEST_EXT_01", + "investigatorName": "", + "sequencingCenter": "MySequencingCenter", + "investigatorEmail": "", + "projectManagerName": "", + "investigatorSampleId": "ALN", + "captureConcentrationNm": null, + "libraryConcentrationNgul": null + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4e2e01d6-78b1-4d57-bfd9-c6f37167a922", + "fields": { + "created_date": "2020-01-14T21:19:57.606Z", + "modified_date": "2020-01-14T21:19:57.606Z", + "file": "0edc3e64-6cfc-4f15-a3cb-6f90fdf01d15", + "version": 0, + "metadata": { + "R": "R2", + "sex": "Unknown", + "runId": null, + "recipe": "CustomCapture", + "baitSet": "IMPACT468_BAITS", + "piEmail": "", + "runDate": null, + "runMode": null, + "species": "Human", + "platform": "MySequencingPlatform", + "sampleId": "ALN-TEST-01", + "barcodeId": null, + "libraryId": "MyLibraryId", + "patientId": "C-ALLANT", + "requestId": "ALN-REQ-ID", + "flowCellId": "MyFlowCellId", + "readLength": null, + "sampleName": "C-ALLANT-T001-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "", + "sampleClass": "Tumor", + "barcodeIndex": "MyBarcodeIndex", + "labHeadEmail": "", + "oncoTreeCode": null, + "preservation": "FFPE", + "sampleOrigin": "Cells", + "specimenType": "Blood", + "flowCellLanes": [], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Tumor", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "ALN_TEST_EXT_01", + "investigatorName": "", + "sequencingCenter": "MySequencingCenter", + "investigatorEmail": "", + "projectManagerName": "", + "investigatorSampleId": "ALN", + "captureConcentrationNm": null, + "libraryConcentrationNgul": null + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2f2bcc28-d7e7-4479-9214-ca88ee64f1ea", + "fields": { + "created_date": "2020-01-14T21:19:56.513Z", + "modified_date": "2020-01-14T21:19:56.513Z", + "file": "04f44221-a5d5-4b4c-84d4-92c8c8a4da5a", + "version": 0, + "metadata": { + "R": "R1", + "sex": "Unknown", + "runId": null, + "recipe": "CustomCapture", + "baitSet": "IMPACT468_BAITS", + "piEmail": "", + "runDate": null, + "runMode": null, + "species": "Human", + "platform": "MySequencingPlatform", + "sampleId": "ALN-TEST-02", + "barcodeId": null, + "libraryId": "MyLibraryId", + "patientId": "C-ALLANT", + "requestId": "ALN-REQ-ID", + "flowCellId": "MyFlowCellId", + "readLength": null, + "sampleName": "C-ALLANT-N002-d", + "captureName": null, + "igocomplete": true, + "labHeadName": "", + "sampleClass": "Normal", + "barcodeIndex": "MyBarcodeIndex", + "labHeadEmail": "", + "oncoTreeCode": null, + "preservation": "FFPE", + "sampleOrigin": "Cells", + "specimenType": "Blood", + "flowCellLanes": [], + "libraryVolume": null, + "pooledNormals": null, + "tumorOrNormal": "Normal", + "captureInputNg": null, + "collectionYear": "", + "tissueLocation": "", + "dataAnalystName": "", + "dataAnalystEmail": "", + "externalSampleId": "ALN_TEST_EXT_02", + "investigatorName": "", + "sequencingCenter": "MySequencingCenter", + "investigatorEmail": "", + "projectManagerName": "", + "investigatorSampleId": "ALN", + "captureConcentrationNm": null, + "libraryConcentrationNgul": null + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4812ac7f-f576-4e53-a90b-4c28f1b08f01", + "fields": { + "created_date": "2019-10-24T00:23:51.276Z", + "modified_date": "2019-10-24T00:23:51.276Z", + "file": "62366951-1c94-4b75-82c6-384d5359cebe", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "253f37c6-304e-463b-9676-bb6defb7f0d4", + "fields": { + "created_date": "2019-10-24T00:23:49.965Z", + "modified_date": "2019-10-24T00:23:49.965Z", + "file": "e339ee8d-4e73-4ca5-907a-eb8296c1cd18", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "728b8284-c0d4-4fd9-b7a4-609435ec2979", + "fields": { + "created_date": "2019-10-24T00:23:50.226Z", + "modified_date": "2019-10-24T00:23:50.226Z", + "file": "ebbb6238-0bdb-4e28-9040-9e257ffb3407", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "aa492cac-94aa-477d-92fd-c6e55e5a5978", + "fields": { + "created_date": "2019-10-24T00:23:44.913Z", + "modified_date": "2019-10-24T00:23:44.913Z", + "file": "7c918d29-514c-447b-81ee-8c7c36ee098c", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "21cc598c-f11b-4306-8246-17333ffa7f7e", + "fields": { + "created_date": "2019-10-24T00:23:51.026Z", + "modified_date": "2019-10-24T00:23:51.026Z", + "file": "f70c128b-3466-4399-99d9-4bf33a5a53fe", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8a5b3c7a-940a-47fe-91ae-f9efd6216c37", + "fields": { + "created_date": "2019-10-24T00:23:47.462Z", + "modified_date": "2019-10-24T00:23:47.462Z", + "file": "8d2afc5f-7fc2-4584-a169-bd978314ae43", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5d118f3c-f527-4ea4-983f-9811a1d422ab", + "fields": { + "created_date": "2019-10-24T00:23:45.402Z", + "modified_date": "2019-10-24T00:23:45.403Z", + "file": "be0ed0ea-33f6-4331-9af9-6439f7b149d0", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "48056c0c-6027-4c08-9f56-38fbc7e35836", + "fields": { + "created_date": "2019-10-24T00:23:50.466Z", + "modified_date": "2019-10-24T00:23:50.466Z", + "file": "0d184175-1f65-4af0-b67d-c93c7d50988a", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a6596e2b-e457-40fd-9889-a8633882d577", + "fields": { + "created_date": "2019-10-24T00:23:43.880Z", + "modified_date": "2019-10-24T00:23:43.880Z", + "file": "b6ae85ba-fd31-475a-b0fe-2a32789a4692", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "89ff106b-a614-4ac3-9f6a-b01cc62d9cea", + "fields": { + "created_date": "2019-10-24T00:23:42.551Z", + "modified_date": "2019-10-24T00:23:42.551Z", + "file": "eaec3382-528f-4b6b-acff-b718c84a8980", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5bbc4dcc-09a8-4d82-b2c2-a795c8cf0eed", + "fields": { + "created_date": "2019-10-24T00:23:51.521Z", + "modified_date": "2019-10-24T00:23:51.521Z", + "file": "c033a8df-2197-4e99-95ba-b47e5659621c", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "868e69fb-7927-4a1f-82e9-e1753a9a4fa2", + "fields": { + "created_date": "2019-10-24T00:23:48.756Z", + "modified_date": "2019-10-24T00:23:48.756Z", + "file": "8e9b5b36-da56-4dc8-a895-0ff14a5457bc", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "298594e8-f70c-4f92-a515-1dc7f5d62f20", + "fields": { + "created_date": "2019-10-24T00:23:42.791Z", + "modified_date": "2019-10-24T00:23:42.791Z", + "file": "e800d375-bd52-4829-9d37-18194d0e8824", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "39382ef1-cff2-42b2-9b6c-0b2208971ec1", + "fields": { + "created_date": "2019-10-24T00:23:48.275Z", + "modified_date": "2019-10-24T00:23:48.275Z", + "file": "84c1c4a4-8ad9-4df8-a30d-fd5d9ec58cc7", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6ee738a8-7a7d-4b25-853a-c37dfa1de00c", + "fields": { + "created_date": "2019-10-24T00:23:43.379Z", + "modified_date": "2019-10-24T00:23:43.379Z", + "file": "9956c92d-395c-49bd-8806-93e94d66f91c", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fbf33358-7170-4c48-8e0a-0d63042dc389", + "fields": { + "created_date": "2019-10-24T00:23:49.242Z", + "modified_date": "2019-10-24T00:23:49.242Z", + "file": "8a8dd9e3-1970-41d9-abfe-8d5f62745cbf", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1c7eb061-a230-437d-a859-9aac1c328b1e", + "fields": { + "created_date": "2019-10-24T00:23:50.707Z", + "modified_date": "2019-10-24T00:23:50.707Z", + "file": "29f16470-1721-4957-9fa4-c42a685e65e9", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "19015e03-e615-4d26-9d34-7aa48d1d3359", + "fields": { + "created_date": "2019-10-24T00:23:52.320Z", + "modified_date": "2019-10-24T00:23:52.320Z", + "file": "31f3fa2b-face-431d-ac31-5e4aa5c1f534", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4545c294-f6c2-4925-8765-11c4041ba4d5", + "fields": { + "created_date": "2019-10-24T00:23:45.649Z", + "modified_date": "2019-10-24T00:23:45.649Z", + "file": "d959d541-f891-441d-9951-a6d1df49fb91", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "11eb6f11-cc5d-4056-897f-0979376d3de4", + "fields": { + "created_date": "2019-10-24T00:23:43.028Z", + "modified_date": "2019-10-24T00:23:43.028Z", + "file": "f085a161-0f9e-4e7d-bef4-dce17f3cf311", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "cf52f0cd-20de-4d20-9d29-6cc033c05c51", + "fields": { + "created_date": "2019-10-24T00:23:43.639Z", + "modified_date": "2019-10-24T00:23:43.639Z", + "file": "a4e02e9e-833e-4dfc-a8d8-caece136a2af", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "949cb199-3543-4bf8-b137-eea46f4accbc", + "fields": { + "created_date": "2019-10-24T00:23:47.712Z", + "modified_date": "2019-10-24T00:23:47.712Z", + "file": "b4f708ff-8bea-47fc-8a4e-3ced60b817b1", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6705f6c0-2cb0-409d-b317-d9d5d9f60212", + "fields": { + "created_date": "2019-10-24T00:23:45.887Z", + "modified_date": "2019-10-24T00:23:45.888Z", + "file": "b75b9ba0-022c-4ec1-87f3-8c81d8b5d88b", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1d803949-9024-469b-a7b6-808058cca955", + "fields": { + "created_date": "2019-10-24T00:23:44.409Z", + "modified_date": "2019-10-24T00:23:44.410Z", + "file": "13b6946e-c047-49b8-bac3-34efddb0847d", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b51db15d-06da-464e-8ede-9465965e8f18", + "fields": { + "created_date": "2019-10-24T00:23:48.998Z", + "modified_date": "2019-10-24T00:23:48.998Z", + "file": "c0298d8e-2dcf-487b-a1c5-888522a55abc", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1ee14694-7d33-4a5e-a93e-aadf622994b9", + "fields": { + "created_date": "2019-10-24T00:23:46.124Z", + "modified_date": "2019-10-24T00:23:46.124Z", + "file": "acccd858-813d-46c3-85da-d7063f051f89", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d0677e55-144e-4338-b65d-4e11aeb88ecf", + "fields": { + "created_date": "2019-10-24T00:23:46.913Z", + "modified_date": "2019-10-24T00:23:46.913Z", + "file": "54b4aef7-46f3-417b-949c-7d44d94b69df", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4bd127e5-f269-42fb-bd5f-e7b4f0b90c69", + "fields": { + "created_date": "2019-10-24T00:23:46.369Z", + "modified_date": "2019-10-24T00:23:46.369Z", + "file": "7a71c994-7c88-4523-8abd-ae50d792ba19", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9cd76ae1-3556-4c80-8f76-7b1a6e6a18c0", + "fields": { + "created_date": "2019-10-24T00:23:45.161Z", + "modified_date": "2019-10-24T00:23:45.161Z", + "file": "312220bd-8bb6-41bd-817f-59217c364fdf", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "47620ea3-3b4b-4c50-82d6-723d5d5a16d8", + "fields": { + "created_date": "2019-10-24T00:23:49.482Z", + "modified_date": "2019-10-24T00:23:49.482Z", + "file": "768c19d8-a4e6-4c14-86d9-8ac6fcd51798", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "422186c3-692b-4ca7-a61b-681d6d5a6101", + "fields": { + "created_date": "2019-10-24T00:23:44.118Z", + "modified_date": "2019-10-24T00:23:44.118Z", + "file": "f4aeecab-b064-4935-a2af-014e633d5ef2", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a27bedd5-e3fd-4916-884b-437f88e20514", + "fields": { + "created_date": "2019-10-24T00:23:48.012Z", + "modified_date": "2019-10-24T00:23:48.012Z", + "file": "fd08b546-720f-4622-b79d-693936d2b608", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6865dfc6-0171-4325-934d-b3431d5b3f67", + "fields": { + "created_date": "2019-10-24T00:23:51.764Z", + "modified_date": "2019-10-24T00:23:51.764Z", + "file": "baa2b1ea-6954-4d48-87f6-017a1786b4eb", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d8b7c067-8a1b-488b-b914-01d277aa564c", + "fields": { + "created_date": "2019-10-24T00:23:52.067Z", + "modified_date": "2019-10-24T00:23:52.067Z", + "file": "fee5555e-ca62-4213-ae2f-a86e45f1ab02", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0f0f34b1-f88a-4a9a-91a6-3c59ea82a80a", + "fields": { + "created_date": "2019-10-24T00:23:44.666Z", + "modified_date": "2019-10-24T00:23:44.666Z", + "file": "7e7c92fd-1653-4de5-b0ad-fb1b35eafd95", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3c637c19-9874-46b4-adc0-973a7f88a47d", + "fields": { + "created_date": "2019-10-24T00:23:49.726Z", + "modified_date": "2019-10-24T00:23:49.726Z", + "file": "87663bfc-8a6f-4c30-9528-85c4c9859abe", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8c38eeeb-4eee-4a7e-aa37-ec6a402f1f4f", + "fields": { + "created_date": "2019-10-24T00:23:42.312Z", + "modified_date": "2019-10-24T00:23:42.312Z", + "file": "4af32904-03d2-4646-822d-8e520239421f", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c6b33d9e-a7b0-4a17-a22d-438ea21b9ba9", + "fields": { + "created_date": "2019-10-24T00:23:48.516Z", + "modified_date": "2019-10-24T00:23:48.516Z", + "file": "938e0e74-bd4a-4d3f-b9e3-c327acad3f44", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d9928da5-fba6-467a-a0c5-6287fbcb3168", + "fields": { + "created_date": "2019-10-24T00:23:46.675Z", + "modified_date": "2019-10-24T00:23:46.675Z", + "file": "63fcfa9f-b2b1-446b-b1e5-0f58803fb2f4", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4e7e10a9-2776-4b42-a724-44a1b8c342a4", + "fields": { + "created_date": "2019-10-24T00:23:47.152Z", + "modified_date": "2019-10-24T00:23:47.152Z", + "file": "d78b21a5-d156-4d96-b532-d7788872f292", + "version": 0, + "metadata": { + "assay": "IMPACT468_b37", + "data_type": "curated_bam" + }, + "user": null + } + }, + { + "model": "file_system.file", + "pk": "8cbed193-0337-45e7-a2b8-b3f62e748960", + "fields": { + "created_date": "2020-03-03T16:36:04.003Z", + "modified_date": "2020-03-03T16:36:04.003Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.hsmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3d2b178a-764a-4979-a6cb-6671fdba4028", + "fields": { + "created_date": "2020-03-03T16:36:03.984Z", + "modified_date": "2020-03-03T16:36:03.984Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.hsmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.hsmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "f3675a4e-bd28-478e-b9f1-276e6c3b0b82", + "fields": { + "created_date": "2020-03-03T16:36:04.335Z", + "modified_date": "2020-03-03T16:36:04.335Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.gcbias.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.gcbias.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1108be83-1004-4ed8-9252-6d876b2f3c05", + "fields": { + "created_date": "2020-03-03T16:36:04.353Z", + "modified_date": "2020-03-03T16:36:04.353Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.gcbias.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.gcbias.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "71e25233-77c1-414d-b762-c549b6b126dc", + "fields": { + "created_date": "2020-03-03T16:36:04.493Z", + "modified_date": "2020-03-03T16:36:04.493Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.vcf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "5c9ed739-c793-42bb-9608-f7d8dde43ea3", + "fields": { + "created_date": "2020-03-03T16:36:04.544Z", + "modified_date": "2020-03-03T16:36:04.544Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.vcf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e50bd157-9e37-4efe-84e3-cbc3790e6373", + "fields": { + "created_date": "2020-03-03T16:36:04.794Z", + "modified_date": "2020-03-03T16:36:04.794Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.cncf.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "191c19cb-39b7-447e-9d5b-13d755a9c5cb", + "fields": { + "created_date": "2020-03-03T16:36:04.987Z", + "modified_date": "2020-03-03T16:36:04.987Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads.dat.gz", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d4dc45ed-987f-44ad-ac86-cee06c5db9ae", + "fields": { + "created_date": "2020-03-03T16:36:03.703Z", + "modified_date": "2020-03-03T16:36:03.703Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.bam", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e0319335-fbc2-4084-a1aa-5dae313bdad6", + "fields": { + "created_date": "2020-03-03T16:36:03.733Z", + "modified_date": "2020-03-03T16:36:03.733Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads.bai", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.bai", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "10b6ae32-a39c-48ff-8a15-afcdb49cb586", + "fields": { + "created_date": "2020-03-03T16:36:03.780Z", + "modified_date": "2020-03-03T16:36:03.780Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.bai", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.bai", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1096779d-eea4-4501-9bb1-a320234590cd", + "fields": { + "created_date": "2020-03-03T16:36:03.759Z", + "modified_date": "2020-03-03T16:36:03.759Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.bam", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.bam", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "83600fed-578a-4ab0-bc37-fc85a93cfaec", + "fields": { + "created_date": "2020-03-03T16:36:03.798Z", + "modified_date": "2020-03-03T16:36:03.798Z", + "file_name": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R1-001.chunk000_cl.stats", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "ae5143ce-aae5-40e7-a8dc-dc7709983b68", + "fields": { + "created_date": "2020-03-03T16:36:03.836Z", + "modified_date": "2020-03-03T16:36:03.836Z", + "file_name": "MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/MyFlowCellId_MyBarcodeIndex-IGO-00000-TEST-L001-R2-001.chunk000_cl.stats", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d42a1d40-5a3a-4cb6-8208-2737bdccc739", + "fields": { + "created_date": "2020-03-03T16:36:03.886Z", + "modified_date": "2020-03-03T16:36:03.886Z", + "file_name": "s_C_ALLANT_T001_d.rg.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md_metrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1e3b4ed9-d8ab-40de-b9b1-6ff3a18f0765", + "fields": { + "created_date": "2020-03-03T16:36:03.912Z", + "modified_date": "2020-03-03T16:36:03.912Z", + "file_name": "s_C_ALLANT_N002_d.rg.md_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md_metrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3ceb6f23-b282-438b-a815-2389ed09d61c", + "fields": { + "created_date": "2020-03-03T16:36:03.963Z", + "modified_date": "2020-03-03T16:36:03.963Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.asmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "79dcaff4-4696-4aca-95ec-11d3b1437e04", + "fields": { + "created_date": "2020-03-03T16:36:03.938Z", + "modified_date": "2020-03-03T16:36:03.939Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.asmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.asmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "320966d6-8645-4962-89ef-9221468124a9", + "fields": { + "created_date": "2020-03-03T16:36:04.025Z", + "modified_date": "2020-03-03T16:36:04.025Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.ismetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3acea0ac-b1c6-4aed-8457-28edba87aa18", + "fields": { + "created_date": "2020-03-03T16:36:04.056Z", + "modified_date": "2020-03-03T16:36:04.057Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.ismetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.ismetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "07f90ced-b997-4380-b3ed-c81af7ca86c2", + "fields": { + "created_date": "2020-03-03T16:36:04.110Z", + "modified_date": "2020-03-03T16:36:04.110Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.ismetrics.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.ismetrics.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "5a77a927-821b-46cb-8d09-82e063959c04", + "fields": { + "created_date": "2020-03-03T16:36:04.084Z", + "modified_date": "2020-03-03T16:36:04.084Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.ismetrics.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.ismetrics.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "5be5a463-f87f-433a-ac95-4344da5e20e6", + "fields": { + "created_date": "2020-03-03T16:36:04.163Z", + "modified_date": "2020-03-03T16:36:04.163Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.hstmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "c7518d11-7b1c-4253-81bc-241cf1a8fef8", + "fields": { + "created_date": "2020-03-03T16:36:04.138Z", + "modified_date": "2020-03-03T16:36:04.138Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.hstmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.hstmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "39dd73c7-48aa-4487-98bb-e9fcfbc76977", + "fields": { + "created_date": "2020-03-03T16:36:04.213Z", + "modified_date": "2020-03-03T16:36:04.213Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "5dae2da0-b73e-4bf0-8299-f21995cf9b03", + "fields": { + "created_date": "2020-03-03T16:36:04.188Z", + "modified_date": "2020-03-03T16:36:04.188Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle_metrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "948b8c85-1393-4367-9747-bc787f5e16a4", + "fields": { + "created_date": "2020-03-03T16:36:04.259Z", + "modified_date": "2020-03-03T16:36:04.259Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "9ebc97a4-604b-4724-954e-64dfd4e3b4f9", + "fields": { + "created_date": "2020-03-03T16:36:04.238Z", + "modified_date": "2020-03-03T16:36:04.238Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.qmetrics.quality_by_cycle.pdf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "91de3419-fd46-44b8-9510-58d0ddb46c0c", + "fields": { + "created_date": "2020-03-03T16:36:04.316Z", + "modified_date": "2020-03-03T16:36:04.316Z", + "file_name": "s_C_ALLANT_N002_d.rg.md_FP_base_counts.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md_FP_base_counts.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "30c777ce-5fa5-46fe-a572-931eeed1fa25", + "fields": { + "created_date": "2020-03-03T16:36:04.286Z", + "modified_date": "2020-03-03T16:36:04.286Z", + "file_name": "s_C_ALLANT_T001_d.rg.md_FP_base_counts.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md_FP_base_counts.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "7777c19f-1114-4e1b-aba3-25b00836ae91", + "fields": { + "created_date": "2020-03-03T16:36:04.389Z", + "modified_date": "2020-03-03T16:36:04.389Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.gcbiasmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "a6778005-a949-4213-ab71-64d7015be161", + "fields": { + "created_date": "2020-03-03T16:36:04.371Z", + "modified_date": "2020-03-03T16:36:04.371Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.gcbiasmetrics", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.gcbiasmetrics", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "a5f70008-97c5-411b-bdda-fb9a71158703", + "fields": { + "created_date": "2020-03-03T16:36:04.406Z", + "modified_date": "2020-03-03T16:36:04.406Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.gcbias.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.gcbias.summary", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "04afed1b-322e-454e-87cf-58fa84a7c60a", + "fields": { + "created_date": "2020-03-03T16:36:04.425Z", + "modified_date": "2020-03-03T16:36:04.425Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.gcbias.summary", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.gcbias.summary", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1e8ae824-8a3a-46f8-9028-6efa69bda6c4", + "fields": { + "created_date": "2020-03-03T16:36:04.472Z", + "modified_date": "2020-03-03T16:36:04.472Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.pileup", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b867978b-8f7b-455a-aac6-7373de68b90b", + "fields": { + "created_date": "2020-03-03T16:36:04.449Z", + "modified_date": "2020-03-03T16:36:04.449Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.pileup", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.pileup", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "fa41aad5-abab-4c7d-ab95-76058ea1bcbc", + "fields": { + "created_date": "2020-03-03T16:36:04.520Z", + "modified_date": "2020-03-03T16:36:04.520Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "e4c3dc41-52b0-42fc-9e39-c90239818fec", + "fields": { + "created_date": "2020-03-03T16:36:04.570Z", + "modified_date": "2020-03-03T16:36:04.570Z", + "file_name": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "41b63b20-488a-4e74-b981-cf7158507c17", + "fields": { + "created_date": "2020-03-03T16:36:04.594Z", + "modified_date": "2020-03-03T16:36:04.594Z", + "file_name": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz.tbi", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.combined-variants.vcf.gz.tbi", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "8acf0380-e6b6-4ead-ba7d-286eeb3ad539", + "fields": { + "created_date": "2020-03-03T16:36:04.618Z", + "modified_date": "2020-03-03T16:36:04.618Z", + "file_name": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants.vcf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.annotate-variants.vcf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "84fcec4d-f86d-486a-9596-69e04310848b", + "fields": { + "created_date": "2020-03-03T16:36:04.670Z", + "modified_date": "2020-03-03T16:36:04.670Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz.tbi", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3d1ccfeb-512c-48dc-8b68-9c60c306d252", + "fields": { + "created_date": "2020-03-03T16:36:04.642Z", + "modified_date": "2020-03-03T16:36:04.642Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.vardict.complex_filtered_STDfilter.norm.vcf.gz", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "b6540a79-f539-4ee6-95ce-c5d5d12bd3bf", + "fields": { + "created_date": "2020-03-03T16:36:04.725Z", + "modified_date": "2020-03-03T16:36:04.725Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz.tbi", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "d89c1c1c-3c06-48f6-b739-245456a02138", + "fields": { + "created_date": "2020-03-03T16:36:04.697Z", + "modified_date": "2020-03-03T16:36:04.697Z", + "file_name": "s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.rg.md.abra.printreads.s_C_ALLANT_N002_d.rg.md.abra.printreads.mutect_STDfilter.norm.vcf.gz", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "7814d883-e5d0-4370-af69-2ce29ce4338d", + "fields": { + "created_date": "2020-03-03T16:36:04.770Z", + "modified_date": "2020-03-03T16:36:04.770Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.CNCF.png", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "fb2118ff-5c2f-403d-b294-d4a646e7b763", + "fields": { + "created_date": "2020-03-03T16:36:04.749Z", + "modified_date": "2020-03-03T16:36:04.749Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF.png", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.CNCF.png", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "6d2972f4-62c1-4f62-b7da-f44475f19239", + "fields": { + "created_date": "2020-03-03T16:36:04.817Z", + "modified_date": "2020-03-03T16:36:04.817Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf.txt", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.cncf.txt", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "7a3f1fce-0449-41c6-ac40-4678d45fec61", + "fields": { + "created_date": "2020-03-03T16:36:04.864Z", + "modified_date": "2020-03-03T16:36:04.864Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.out", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "f4d6350f-4fd5-4eee-a56a-136d58682ebc", + "fields": { + "created_date": "2020-03-03T16:36:04.840Z", + "modified_date": "2020-03-03T16:36:04.840Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.out", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.out", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3f4fbe18-120b-4657-9be2-4023fa8f8394", + "fields": { + "created_date": "2020-03-03T16:36:04.886Z", + "modified_date": "2020-03-03T16:36:04.886Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.Rdata", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3b8b7ab6-ab40-472d-b6b4-d8538d67be06", + "fields": { + "created_date": "2020-03-03T16:36:04.914Z", + "modified_date": "2020-03-03T16:36:04.914Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.Rdata", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.Rdata", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "1710c96e-24a6-4b7c-bb28-80c7ed8d0518", + "fields": { + "created_date": "2020-03-03T16:36:04.937Z", + "modified_date": "2020-03-03T16:36:04.937Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_hisens.seg", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "3007708d-ab3b-45d9-a3f7-6bfcb7852b7b", + "fields": { + "created_date": "2020-03-03T16:36:04.964Z", + "modified_date": "2020-03-03T16:36:04.964Z", + "file_name": "s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.seg", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_N002_d.rg.md.abra.printreads__s_C_ALLANT_T001_d.rg.md.abra.printreads_purity.seg", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.file", + "pk": "959aa6f8-777b-435d-8cbe-0570c95e25b4", + "fields": { + "created_date": "2020-03-03T16:36:05.005Z", + "modified_date": "2020-03-03T16:36:05.005Z", + "file_name": "s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts.maf", + "path": "/juno/work/pi/beagle/output/roslin_pair_workflow/dfefc47b-3ee4-4867-890f-9bab87c7f53f/outputs/s_C_ALLANT_T001_d.s_C_ALLANT_N002_d.muts.maf", + "file_type": 21, + "size": 0, + "file_group": "a975f490-1b02-4575-abae-a4f8e3667733" + } + }, + { + "model": "file_system.filemetadata", + "pk": "2ea9e784-f18c-4919-9a98-9263ad6ae149", + "fields": { + "created_date": "2020-03-03T16:36:04.006Z", + "modified_date": "2020-03-03T16:36:04.006Z", + "file": "8cbed193-0337-45e7-a2b8-b3f62e748960", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "591f54a1-5cd9-434b-9419-3f7b3d5b1578", + "fields": { + "created_date": "2020-03-03T16:36:03.986Z", + "modified_date": "2020-03-03T16:36:03.986Z", + "file": "3d2b178a-764a-4979-a6cb-6671fdba4028", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a53883a2-a0fa-42b3-92af-956e49cd3c79", + "fields": { + "created_date": "2020-03-03T16:36:04.338Z", + "modified_date": "2020-03-03T16:36:04.338Z", + "file": "f3675a4e-bd28-478e-b9f1-276e6c3b0b82", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3b24b4b4-4f7a-43d0-9716-8172eef46a03", + "fields": { + "created_date": "2020-03-03T16:36:04.355Z", + "modified_date": "2020-03-03T16:36:04.355Z", + "file": "1108be83-1004-4ed8-9252-6d876b2f3c05", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e4ae5f6b-e7a9-40dc-89d9-1a8a12fe9042", + "fields": { + "created_date": "2020-03-03T16:36:04.495Z", + "modified_date": "2020-03-03T16:36:04.495Z", + "file": "71e25233-77c1-414d-b762-c549b6b126dc", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "95677137-ccac-4da8-8397-361800d3af1d", + "fields": { + "created_date": "2020-03-03T16:36:04.548Z", + "modified_date": "2020-03-03T16:36:04.548Z", + "file": "5c9ed739-c793-42bb-9608-f7d8dde43ea3", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ab8e1f9e-99c3-4b37-b712-3b41b4924467", + "fields": { + "created_date": "2020-03-03T16:36:04.796Z", + "modified_date": "2020-03-03T16:36:04.796Z", + "file": "e50bd157-9e37-4efe-84e3-cbc3790e6373", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "d13a872f-2ad0-4b20-b94d-ca7dbc0d0ed1", + "fields": { + "created_date": "2020-03-03T16:36:04.989Z", + "modified_date": "2020-03-03T16:36:04.989Z", + "file": "191c19cb-39b7-447e-9d5b-13d755a9c5cb", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "04eb4524-7e0c-42b4-8ddc-b65c1c4a2a43", + "fields": { + "created_date": "2020-03-03T16:36:03.710Z", + "modified_date": "2020-03-03T16:36:03.710Z", + "file": "d4dc45ed-987f-44ad-ac86-cee06c5db9ae", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ab4896f5-3d15-48cd-9a02-73f03c6964d3", + "fields": { + "created_date": "2020-03-03T16:36:03.736Z", + "modified_date": "2020-03-03T16:36:03.736Z", + "file": "e0319335-fbc2-4084-a1aa-5dae313bdad6", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4396e50b-0b6a-4c0a-86b8-6722148e11ac", + "fields": { + "created_date": "2020-03-03T16:36:03.782Z", + "modified_date": "2020-03-03T16:36:03.782Z", + "file": "10b6ae32-a39c-48ff-8a15-afcdb49cb586", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "845353bb-bace-4dd1-af15-14b2460b3372", + "fields": { + "created_date": "2020-03-03T16:36:03.761Z", + "modified_date": "2020-03-03T16:36:03.761Z", + "file": "1096779d-eea4-4501-9bb1-a320234590cd", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b64ee478-a37b-48bb-8bca-8f2914ec66d8", + "fields": { + "created_date": "2020-03-03T16:36:03.802Z", + "modified_date": "2020-03-03T16:36:03.802Z", + "file": "83600fed-578a-4ab0-bc37-fc85a93cfaec", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "21392456-4364-45ae-a155-04251946d4e6", + "fields": { + "created_date": "2020-03-03T16:36:03.839Z", + "modified_date": "2020-03-03T16:36:03.839Z", + "file": "ae5143ce-aae5-40e7-a8dc-dc7709983b68", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6b1630e3-8377-4c18-af68-ffca112f444f", + "fields": { + "created_date": "2020-03-03T16:36:03.889Z", + "modified_date": "2020-03-03T16:36:03.889Z", + "file": "d42a1d40-5a3a-4cb6-8208-2737bdccc739", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6eb619b9-42c7-4e1d-adf1-a875ca50b122", + "fields": { + "created_date": "2020-03-03T16:36:03.914Z", + "modified_date": "2020-03-03T16:36:03.914Z", + "file": "1e3b4ed9-d8ab-40de-b9b1-6ff3a18f0765", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "1e7904e7-7285-4b83-a45a-c4231eff7652", + "fields": { + "created_date": "2020-03-03T16:36:03.966Z", + "modified_date": "2020-03-03T16:36:03.966Z", + "file": "3ceb6f23-b282-438b-a815-2389ed09d61c", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "35a1a3cb-7262-407e-908b-a30ee7fd26b5", + "fields": { + "created_date": "2020-03-03T16:36:03.942Z", + "modified_date": "2020-03-03T16:36:03.942Z", + "file": "79dcaff4-4696-4aca-95ec-11d3b1437e04", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "40487e17-5a03-420d-ac3e-0b4a4f8240c9", + "fields": { + "created_date": "2020-03-03T16:36:04.030Z", + "modified_date": "2020-03-03T16:36:04.030Z", + "file": "320966d6-8645-4962-89ef-9221468124a9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "0b886d01-0c3a-4aae-83f0-d902c8fa2577", + "fields": { + "created_date": "2020-03-03T16:36:04.059Z", + "modified_date": "2020-03-03T16:36:04.059Z", + "file": "3acea0ac-b1c6-4aed-8457-28edba87aa18", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ecf829b8-8954-4a33-a238-7f38ae8a2a08", + "fields": { + "created_date": "2020-03-03T16:36:04.114Z", + "modified_date": "2020-03-03T16:36:04.114Z", + "file": "07f90ced-b997-4380-b3ed-c81af7ca86c2", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4040c50b-e202-4d5b-a640-ddb6eb69dd02", + "fields": { + "created_date": "2020-03-03T16:36:04.087Z", + "modified_date": "2020-03-03T16:36:04.087Z", + "file": "5a77a927-821b-46cb-8d09-82e063959c04", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "013856ee-c921-4a5e-b3b3-2c22e080f44c", + "fields": { + "created_date": "2020-03-03T16:36:04.166Z", + "modified_date": "2020-03-03T16:36:04.166Z", + "file": "5be5a463-f87f-433a-ac95-4344da5e20e6", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "2ee28683-8e06-4f4f-8290-f61658edeb2d", + "fields": { + "created_date": "2020-03-03T16:36:04.141Z", + "modified_date": "2020-03-03T16:36:04.141Z", + "file": "c7518d11-7b1c-4253-81bc-241cf1a8fef8", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "62d738c4-7315-4b46-b8e5-c0e537ad09c8", + "fields": { + "created_date": "2020-03-03T16:36:04.216Z", + "modified_date": "2020-03-03T16:36:04.216Z", + "file": "39dd73c7-48aa-4487-98bb-e9fcfbc76977", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "cab0089b-afc9-419e-9196-01932cf48c3a", + "fields": { + "created_date": "2020-03-03T16:36:04.192Z", + "modified_date": "2020-03-03T16:36:04.192Z", + "file": "5dae2da0-b73e-4bf0-8299-f21995cf9b03", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "8a057dbf-dcf3-4056-83db-580a8db01a74", + "fields": { + "created_date": "2020-03-03T16:36:04.262Z", + "modified_date": "2020-03-03T16:36:04.262Z", + "file": "948b8c85-1393-4367-9747-bc787f5e16a4", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "196dc3d4-bb77-4061-9c56-3872e4fb9d41", + "fields": { + "created_date": "2020-03-03T16:36:04.240Z", + "modified_date": "2020-03-03T16:36:04.240Z", + "file": "9ebc97a4-604b-4724-954e-64dfd4e3b4f9", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "ca8e4bb4-fdb8-4c86-adf1-3fd948733169", + "fields": { + "created_date": "2020-03-03T16:36:04.318Z", + "modified_date": "2020-03-03T16:36:04.318Z", + "file": "91de3419-fd46-44b8-9510-58d0ddb46c0c", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "551cfd69-9018-4cc0-8678-92c9955653f1", + "fields": { + "created_date": "2020-03-03T16:36:04.290Z", + "modified_date": "2020-03-03T16:36:04.290Z", + "file": "30c777ce-5fa5-46fe-a572-931eeed1fa25", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "7fe5c523-fcbd-4698-b7fb-17ac22e1e4c6", + "fields": { + "created_date": "2020-03-03T16:36:04.392Z", + "modified_date": "2020-03-03T16:36:04.392Z", + "file": "7777c19f-1114-4e1b-aba3-25b00836ae91", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "b904bb28-d8ad-44ff-977f-96831786b43f", + "fields": { + "created_date": "2020-03-03T16:36:04.374Z", + "modified_date": "2020-03-03T16:36:04.374Z", + "file": "a6778005-a949-4213-ab71-64d7015be161", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "90ff6135-314c-4d81-9309-5b35d79ef952", + "fields": { + "created_date": "2020-03-03T16:36:04.408Z", + "modified_date": "2020-03-03T16:36:04.408Z", + "file": "a5f70008-97c5-411b-bdda-fb9a71158703", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "9d0865f1-960c-4930-8de9-7573f191e51a", + "fields": { + "created_date": "2020-03-03T16:36:04.427Z", + "modified_date": "2020-03-03T16:36:04.427Z", + "file": "04afed1b-322e-454e-87cf-58fa84a7c60a", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c4e0b244-1917-4ce1-a63c-74c679d7c422", + "fields": { + "created_date": "2020-03-03T16:36:04.474Z", + "modified_date": "2020-03-03T16:36:04.474Z", + "file": "1e8ae824-8a3a-46f8-9028-6efa69bda6c4", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "bacc4031-7960-4815-b9f6-8a605a493790", + "fields": { + "created_date": "2020-03-03T16:36:04.452Z", + "modified_date": "2020-03-03T16:36:04.452Z", + "file": "b867978b-8f7b-455a-aac6-7373de68b90b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "776e969a-dbb6-49ee-9108-8f783d9f7126", + "fields": { + "created_date": "2020-03-03T16:36:04.523Z", + "modified_date": "2020-03-03T16:36:04.523Z", + "file": "fa41aad5-abab-4c7d-ab95-76058ea1bcbc", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "4a797d81-df28-481b-8bc5-2f7819e44532", + "fields": { + "created_date": "2020-03-03T16:36:04.573Z", + "modified_date": "2020-03-03T16:36:04.573Z", + "file": "e4c3dc41-52b0-42fc-9e39-c90239818fec", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "25041feb-b3ba-4359-8bc4-c277f0a39ee6", + "fields": { + "created_date": "2020-03-03T16:36:04.596Z", + "modified_date": "2020-03-03T16:36:04.596Z", + "file": "41b63b20-488a-4e74-b981-cf7158507c17", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "6251a9a2-4846-4793-8932-52ddb64ac949", + "fields": { + "created_date": "2020-03-03T16:36:04.621Z", + "modified_date": "2020-03-03T16:36:04.621Z", + "file": "8acf0380-e6b6-4ead-ba7d-286eeb3ad539", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3d214932-d37e-444d-91d2-80836cb9af5b", + "fields": { + "created_date": "2020-03-03T16:36:04.674Z", + "modified_date": "2020-03-03T16:36:04.674Z", + "file": "84fcec4d-f86d-486a-9596-69e04310848b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "c293c7de-2563-471d-acfe-7de409c4a185", + "fields": { + "created_date": "2020-03-03T16:36:04.645Z", + "modified_date": "2020-03-03T16:36:04.645Z", + "file": "3d1ccfeb-512c-48dc-8b68-9c60c306d252", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "788f1ca4-fb5c-49d8-b7f9-47c8f0533bce", + "fields": { + "created_date": "2020-03-03T16:36:04.728Z", + "modified_date": "2020-03-03T16:36:04.728Z", + "file": "b6540a79-f539-4ee6-95ce-c5d5d12bd3bf", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "5720757c-5fa0-4be7-b75c-2efa59fefec6", + "fields": { + "created_date": "2020-03-03T16:36:04.702Z", + "modified_date": "2020-03-03T16:36:04.702Z", + "file": "d89c1c1c-3c06-48f6-b739-245456a02138", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "58e8c389-1143-4ff2-9a59-eb01c3927570", + "fields": { + "created_date": "2020-03-03T16:36:04.772Z", + "modified_date": "2020-03-03T16:36:04.772Z", + "file": "7814d883-e5d0-4370-af69-2ce29ce4338d", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "a080ad82-1d17-45c6-9dc4-610837469be5", + "fields": { + "created_date": "2020-03-03T16:36:04.752Z", + "modified_date": "2020-03-03T16:36:04.752Z", + "file": "fb2118ff-5c2f-403d-b294-d4a646e7b763", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e31b3863-5cef-4138-8cf8-079dab8016a3", + "fields": { + "created_date": "2020-03-03T16:36:04.819Z", + "modified_date": "2020-03-03T16:36:04.819Z", + "file": "6d2972f4-62c1-4f62-b7da-f44475f19239", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "34d6d5cf-094c-4ba3-b06b-b0c42e74d155", + "fields": { + "created_date": "2020-03-03T16:36:04.867Z", + "modified_date": "2020-03-03T16:36:04.867Z", + "file": "7a3f1fce-0449-41c6-ac40-4678d45fec61", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "fecb1ca0-8d79-4455-807b-cb6ca200d38f", + "fields": { + "created_date": "2020-03-03T16:36:04.843Z", + "modified_date": "2020-03-03T16:36:04.843Z", + "file": "f4d6350f-4fd5-4eee-a56a-136d58682ebc", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "cfe5841e-fa98-4a01-bd8b-f7ebd29ced3f", + "fields": { + "created_date": "2020-03-03T16:36:04.889Z", + "modified_date": "2020-03-03T16:36:04.889Z", + "file": "3f4fbe18-120b-4657-9be2-4023fa8f8394", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "94d6c522-e9d9-4c74-b572-1b4ae6b1220f", + "fields": { + "created_date": "2020-03-03T16:36:04.917Z", + "modified_date": "2020-03-03T16:36:04.917Z", + "file": "3b8b7ab6-ab40-472d-b6b4-d8538d67be06", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "e943fb08-d544-4d81-a5ae-84d2e22afb35", + "fields": { + "created_date": "2020-03-03T16:36:04.940Z", + "modified_date": "2020-03-03T16:36:04.940Z", + "file": "1710c96e-24a6-4b7c-bb28-80c7ed8d0518", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "52c644d2-3a06-4b46-b12c-9e89b37ef900", + "fields": { + "created_date": "2020-03-03T16:36:04.967Z", + "modified_date": "2020-03-03T16:36:04.967Z", + "file": "3007708d-ab3b-45d9-a3f7-6bfcb7852b7b", + "version": 0, + "metadata": {}, + "user": null + } + }, + { + "model": "file_system.filemetadata", + "pk": "3fa7af8b-472a-43c8-a2bc-a430968a5a3e", + "fields": { + "created_date": "2020-03-03T16:36:05.007Z", + "modified_date": "2020-03-03T16:36:05.007Z", + "file": "959aa6f8-777b-435d-8cbe-0570c95e25b4", + "version": 0, + "metadata": {}, + "user": null + } + } +] diff --git a/runner/fixtures/runner.pipeline.json b/runner/fixtures/runner.pipeline.json index 1f61578b3..9858dfaed 100644 --- a/runner/fixtures/runner.pipeline.json +++ b/runner/fixtures/runner.pipeline.json @@ -10,7 +10,8 @@ "version": "0.1.0", "entrypoint": "align_sort_bam.cwl", "output_file_group": "a66f03b4-ce43-40d0-9134-d5a3575cabae", - "output_directory": null + "output_directory": null, + "operator": null } }, { @@ -24,22 +25,8 @@ "version": "0.1.1", "entrypoint": "fastq_to_bam.cwl", "output_file_group": "d9015037-cd6b-4cb6-87a8-16d355482461", - "output_directory": "/work/pi/beagle/output/access_m1" - } - }, - { - "model": "runner.pipeline", - "pk": "cb5d793b-e650-4b7d-bfcd-882858e29cc5", - "fields": { - "created_date": "2019-11-18T17:46:45.118Z", - "modified_date": "2019-12-05T01:12:39.854Z", - "name": "roslin", - "github": "https://github.com/mskcc/roslin-cwl", - "version": "1.0.0-rc5", - "entrypoint": "workflows/pair-workflow-sv.cwl", - "output_file_group": "a975f490-1b02-4575-abae-a4f8e3667733", - "output_directory": "/juno/work/pi/beagle/output/roslin_pair_sv", - "operator": 1 + "output_directory": "/work/pi/beagle/output/access_m1", + "operator": null } }, { @@ -53,7 +40,8 @@ "version": "master", "entrypoint": "flatbush.cwl", "output_file_group": "a66f03b4-ce43-40d0-9134-d5a3575cabae", - "output_directory": "/juno/work/pi/beagle/output/flatbush" + "output_directory": "/juno/work/pi/beagle/output/flatbush", + "operator": null } }, { @@ -67,21 +55,53 @@ "version": "1.0.0-rc5", "entrypoint": "modules/project/generate-qc.cwl", "output_file_group": "a975f490-1b02-4575-abae-a4f8e3667733", - "output_directory": "/juno/work/pi/beagle/output/roslin-qc" + "output_directory": "/juno/work/pi/beagle/output/roslin-qc", + "operator": null + } }, { "model": "runner.pipeline", - "pk": "65419097-a2b8-4d57-a8ab-c4c4cddcbea8", + "pk": "cb5d793b-e650-4b7d-bfcd-882858e29cc5", "fields": { "created_date": "2019-11-18T17:46:45.118Z", - "modified_date": "2019-12-05T01:12:39.854Z", - "name": "copy_outputs", + "modified_date": "2020-02-26T22:22:30.099Z", + "name": "roslin", + "github": "https://github.com/mskcc/roslin-cwl", + "version": "feature/3.0.0_release", + "entrypoint": "workflows/pair-workflow-sv.cwl", + "output_file_group": "a975f490-1b02-4575-abae-a4f8e3667733", + "output_directory": "/juno/work/pi/beagle/output/roslin_pair_sv", + "operator": 1 + } + }, + { + "model": "runner.pipeline", + "pk": "06792b3f-f9dc-4ad1-80a7-2a7af300f000", + "fields": { + "created_date": "2020-02-25T17:04:46.410Z", + "modified_date": "2020-03-03T15:12:51.891Z", + "name": "roslin-dev", + "github": "https://github.com/mskcc/roslin-cwl", + "version": "3.0.0", + "entrypoint": "workflows/pair-workflow-sv.cwl", + "output_file_group": "1a1b29cf-3bc2-4f6c-b376-d4c5d701166a", + "output_directory": "/juno/work/ci/kellys5/projects/beagle-dev/beagle-dev4/output/roslin-dev", + "operator": 5 + } + }, + { + "model": "runner.pipeline", + "pk": "c7849f2b-9a4f-4352-acde-1d993af379d8", + "fields": { + "created_date": "2020-01-22T18:15:20.875Z", + "modified_date": "2020-03-02T17:43:21.328Z", + "name": "roslin-pair-workflow", "github": "https://github.com/mskcc/roslin-cwl", - "version": "1.0.0", - "entrypoint": "workflows/copy_outputs.cwl", + "version": "feature/3.0.0_release", + "entrypoint": "workflows/pair-workflow.cwl", "output_file_group": "a975f490-1b02-4575-abae-a4f8e3667733", - "output_directory": "/juno/work/pi/beagle/output/copy_outputs", - "operator": 4 + "output_directory": "/juno/work/pi/beagle/output/roslin_pair_workflow", + "operator": 3 } } ] diff --git a/runner/operator/roslin_qc_operator/bin/input.py b/runner/operator/roslin_qc_operator/bin/input.py index 26ff745c9..95d6a50e1 100644 --- a/runner/operator/roslin_qc_operator/bin/input.py +++ b/runner/operator/roslin_qc_operator/bin/input.py @@ -26,6 +26,7 @@ conpair_pileups: [conpair_pileups] pairs: [pair] """ +import os import json import urllib from file_system.models import FileMetadata, File @@ -101,13 +102,6 @@ def path_to_job_data(filepath): } return(d) -def get_assay_from_run(run_instance): - """ - Return the assay from a Run instance - This is a hold-over method until Run instance db model gets updated; update this later - """ - return(run_instance.output_metadata['assay']) - def create_files_data_from_ports_with_names(ports): """ Retrieve the File entries for each Port entry, while keeping the associated Port.name attribute @@ -165,21 +159,36 @@ def parse_pairs_from_ports(ports_queryset): def parse_bams_from_ports(ports_queryset): """ Search a set of Ports for the 'bams' entries and format them into a list of tumor normal pair entries - """ - bam_ports = ports_queryset.filter(name = "bams") - bams = [] - for bam in bam_ports: - # get the Beagle database id for each bam file out of the `db_value` field` - # TODO: need to refactor this to get it from the Port.files association; right now that association lacks the tumor/normal information needed to know which bam is which - files_data = bam.db_value - tumor_bam_data = files_data[0] - tumor_bam_bid = urllib.parse.urlsplit(tumor_bam_data['location']).netloc - tumor_bam_file_instance = File.objects.get(id = tumor_bam_bid) - normal_bam_data = files_data[1] - normal_bam_bid = urllib.parse.urlsplit(normal_bam_data['location']).netloc - normal_bam_file_instance = File.objects.get(id = normal_bam_bid) - bams.append([tumor_bam_file_instance, normal_bam_file_instance]) - return(bams) + + TODO: what to do if there are multiple 'normal_bam' and 'tumor_bam'? + """ + normal_bam_port = ports_queryset.filter(name = "normal_bam").first() + tumor_bam_port = ports_queryset.filter(name = "tumor_bam").first() + + # each Port has two files; the .bam and .bai + # based on just the foreign key in Port.files, you cannot tell which is the .bam and which is the .bai + # so we need to check the file extension and sort them out + normal_items = {} + tumor_items = {} + for file_instance in normal_bam_port.files.all(): + # file_name might end up being a URI + filepath = urllib.parse.urlsplit(file_instance.file_name).path + filename, file_extension = os.path.splitext(filepath) + normal_items[file_extension] = file_instance + for file_instance in tumor_bam_port.files.all(): + filepath = urllib.parse.urlsplit(file_instance.file_name).path + filename, file_extension = os.path.splitext(filepath) + tumor_items[file_extension] = file_instance + + # now make a sensible output mapping to the files + output_items = { + 'normal_bam' : normal_items['.bam'], + 'normal_bai' : normal_items['.bai'], + 'tumor_bam' : tumor_items['.bam'], + 'tumor_bai' : tumor_items['.bai'] + } + + return(output_items) def pair_to_cwl(pair): """ @@ -246,44 +255,70 @@ def pair_to_job_data(pair): output = (tumor, normal) return(output) -def bams_to_cwl(bams): +def bams_to_job_data(bams): """ - Convert the items in the bams list to CWL format + Convert the set of bam files into the datastructure needed for the Job JSON - bams = [ [File.objects.get(file_name = 's_C_K2902H_P001_d.rg.md.abra.printreads.bam'), File.objects.get(file_name = 's_C_K2902H_N001_d.rg.md.abra.printreads.bam')], ... ] + bams = { + 'normal_bam' : File.objects.get(...), + 'normal_bai' : File.objects.get(...), + 'tumor_bam' : File.objects.get(...), + 'tumor_bai' : File.objects.get(...) + } """ - bam_cwls = [] - for item in bams: - tumor_bam = item[0] - normal_bam = item[1] - tumor_bam_cwl = file_to_job_data(tumor_bam) - normal_bam_cwl = file_to_job_data(normal_bam) - bam_cwls.append([tumor_bam_cwl, normal_bam_cwl]) - return(bam_cwls) + job_data = [] + job_data.append(file_to_job_data(bams['tumor_bam'])) + job_data.append(file_to_job_data(bams['normal_bam'])) + return(job_data) def parse_runparams_from_ports(ports_queryset): """ Get the runparams from a Port queryset """ # TODO: how to ensure the correct number of Port items? Should be 1 + # TODO: how to handle multiple sets of runparams in the ports queryset???? param_port = ports_queryset.filter(name = "runparams").first() runparams = {} - runparams['project_prefix'] = param_port.value['project_prefix'][0] # NOTE: comes in as array but need single string + runparams['project_prefix'] = param_port.value['project_prefix'] runparams['genome'] = param_port.value['genome'] runparams['scripts_bin'] = param_port.value['scripts_bin'] + runparams['assay'] = param_port.value['assay'] - # TODO: find a way to handle - runparams['pi'] = "NA" - runparams['pi_email'] = "NA" + # at the time of writing these, 'pi' and 'pi_email' were not output by Roslin pipeline but were needed by Roslin QC pipeline + if 'pi' not in runparams: + runparams['pi'] = "NA" + if 'pi_email' not in runparams: + runparams['pi_email'] = "NA" return(runparams) +def get_baits_and_targets(assay): + """ + get a assay label that matches the known keys in roslin_resources.json + + copy paste'd from Roslin QC Operator; https://github.com/mskcc/beagle/blob/032b7aeb5abedfdae6e6b434c4f231f5645a2df8/runner/operator/roslin_operator/construct_roslin_pair.py#L94 + """ + if assay.find("IMPACT410") > -1: + return("IMPACT410_b37") + if assay.find("IMPACT468") > -1: + return("IMPACT468_b37") + if assay.find("IMPACT341") > -1: + return("IMPACT341_b37") + if assay.find("IDT_Exome_v1_FP") > -1: + return("IDT_Exome_v1_FP_b37") + if assay.find("IMPACT468+08390") > -1: + return("IMPACT468_08390") + if assay.find("IMPACT468+Poirier_RB1_intron_V2") > -1: + return("IMPACT468_08050") + def get_db_files(assay, references_json = "runner/operator/roslin_operator/reference_jsons/roslin_resources.json"): """ Return a dict with the required reference file paths """ + # assay does not actually always match the key needed to figure out the reference files + better_assay = get_baits_and_targets(assay) references = json.load(open(references_json)) db_files = {} - db_files['fp_genotypes'] = references["targets"][assay]['FP_genotypes'] + db_files['fp_genotypes'] = references["targets"][better_assay]['FP_genotypes'] db_files['hotspot_list_maf'] = references["request_files"]['hotspot_list_maf'] db_files['conpair_markers'] = references["request_files"]['conpair_markers'] db_files['ref_fasta'] = references["request_files"]['ref_fasta'] @@ -296,18 +331,6 @@ def get_db_files(assay, references_json = "runner/operator/roslin_operator/refer db_files[key] = path_to_job_data(parts.path) elif value.startswith('/'): db_files[key] = path_to_job_data(db_files[key]) - # TODO: do these need to be changed?? - - # check for URI ref_fasta; 'juno:///juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta' - # for key, value in db_files.items(): - # if value.startswith('juno:///'): - # pass - # # parts = urllib.parse.urlsplit(value) - # # db_files[key] = path_to_cwl(parts.path) - # elif value.startswith('/'): - # db_files[key] = path_to_job_data(value) - # TODO: what to do if its not either of these cases? - return(db_files) def parse_outputs_files_data(files_data): @@ -340,7 +363,7 @@ def parse_outputs_files_data(files_data): qc_input[item_type].append(file_data) return(qc_input) -def build_inputs_from_runs(run_queryset, _assay = None): +def build_inputs_from_runs(run_queryset): """ Build the Roslin QC pipeline inputs data structure from a set of Roslin Voyager pipeline Run instances """ @@ -351,43 +374,35 @@ def build_inputs_from_runs(run_queryset, _assay = None): pairs = parse_pairs_from_ports(ports) # convert the pairs to CWL format datastructure - pairs_cwl = [] + pairs_job_data = [] for pair_set in pairs: - pair_cwl = pair_to_cwl(pair_set) - pairs_cwl.append(pair_cwl) + job_data = pair_to_job_data(pair_set) + pairs_job_data.append(job_data) # get the File entries while keeping Port.name; needed for later parsing files_data = create_files_data_from_ports_with_names(ports) input_files = parse_outputs_files_data(files_data) - # need to get the assay type so that we can get the correct reference files later - # TODO: how to handle multiple runs? just use the first one for now... - if _assay == None: - assay = get_assay_from_run(run_queryset.first()) - else: - assay = str(_assay) - # find the Port with 'runparams' needed for QC input runparams = parse_runparams_from_ports(ports) - runparams['assay'] = assay # get the correct reference files based on assay type - db_files = get_db_files(assay) + db_files = get_db_files(runparams['assay']) ref_fasta = db_files.pop('ref_fasta') # get the .bam files needed for QC input bams = parse_bams_from_ports(ports) # convert to CWL output format - bams_cwl = bams_to_cwl(bams) + bams_job_data = bams_to_job_data(bams) # build the final data dict for QC input qc_input = {} qc_input['db_files'] = db_files qc_input['runparams'] = runparams - qc_input['pairs'] = pairs_cwl + qc_input['pairs'] = pairs_job_data qc_input['ref_fasta'] = ref_fasta - qc_input['bams'] = bams_cwl + qc_input['bams'] = bams_job_data qc_input['directories'] = [] qc_input['files'] = [] qc_input = {**qc_input, **input_files} diff --git a/runner/tests/operator/roslin_qc_operator/test_input.py b/runner/tests/operator/roslin_qc_operator/test_input.py index b5ac3f0ec..d87969655 100644 --- a/runner/tests/operator/roslin_qc_operator/test_input.py +++ b/runner/tests/operator/roslin_qc_operator/test_input.py @@ -13,7 +13,7 @@ from runner.operator.roslin_qc_operator.bin.input import parse_pairs_from_ports from runner.operator.roslin_qc_operator.bin.input import parse_runparams_from_ports from runner.operator.roslin_qc_operator.bin.input import get_db_files -from runner.operator.roslin_qc_operator.bin.input import get_assay_from_run +from runner.operator.roslin_qc_operator.bin.input import get_baits_and_targets from runner.operator.roslin_qc_operator.bin.input import build_inputs_from_runs from runner.operator.roslin_qc_operator.bin.input import file_to_cwl from runner.operator.roslin_qc_operator.bin.input import path_to_cwl @@ -33,35 +33,6 @@ class TestInput(TestCase): "beagle_etl.operator.json" ] - def test_true(self): - self.assertTrue(True) - - def test_validate_fixtures1(self): - """ - Check the validity of the fixtures for use with testing for this module to make sure it matches expected criteria - Using saved Roslin pipeline output dataset - """ - # start with empty db - self.assertTrue(len(Run.objects.all()) == 0) - self.assertTrue(len(Port.objects.all()) == 0) - self.assertTrue(len(File.objects.all()) == 0) - self.assertTrue(len(FileMetadata.objects.all()) == 0) - - # load test pipeline Run output fixtures - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") - call_command('loaddata', test_files_fixture, verbosity=0) - - # make sure fixtures match expected criteria - self.assertTrue(len(Run.objects.all()) == 1) - self.assertTrue(len(Port.objects.all()) == 47) - self.assertTrue(len(File.objects.all()) == 121) - self.assertTrue(len(FileMetadata.objects.all()) == 121) - - # make sure expected number of inputs and outputs exist - run_instance = Run.objects.first() - self.assertEqual(len(run_instance.port_set.filter(port_type=PortType.INPUT)), 12) - self.assertEqual(len(run_instance.port_set.filter(port_type=PortType.OUTPUT)), 35) - def test_file_to_cwl1(self): """ Test conversion of a File instance to an equivalent CWL entry @@ -90,57 +61,45 @@ def test_path_to_cwl1(self): expected_job_data = {'class': 'File', 'location': 'juno:///path/to/foo.txt'} self.assertEqual(job_data, expected_job_data) - def test_get_assay_from_run1(self): - """ - Test that correct assay is returned from fixture - This behavior is likely to change in the future - """ - # load test pipeline Run output fixtures - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") - call_command('loaddata', test_files_fixture, verbosity=0) - run_instance = Run.objects.first() - assay = get_assay_from_run(run_instance) - self.assertEqual(assay, 'IDT_Exome_v1_FP_b37') - def test_build_sample1(self): """ Test building of the base dict datastructure to be used later in Roslin CWL output """ - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json") call_command('loaddata', test_files_fixture, verbosity=0) - file_instance = File.objects.get(file_name = 'P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz') + file_instance = File.objects.get(file_name = 'DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz') filemetadata_instance = FileMetadata.objects.filter(file = file_instance).order_by('-version').first() sample = build_sample(filemetadata_instance = filemetadata_instance) expected_sample = {'CN': 'MSKCC', - 'ID': 'C-K2902H-N001-d_H7FKJBBXY', - 'LB': '09670_D_46_1', - 'PL': 'Illumina', - 'PU': 'H7FKJBBXY', - 'SM': 'C-K2902H-N001-d', - 'bait_set': 'IDT_Exome_v1_FP_BAITS', - 'igo_id': '09670_D_46', - 'patient_id': 'C-K2902H', - 'request_id': '09670_D', - 'run_date': '2019-08-19', - 'species': 'Human', - 'specimen_type': 'Blood', - 'tumor_type': 'Normal'} + 'PL': 'Illumina', + 'PU': 'MyFlowCellId', + 'LB': 'MyLibraryId', + 'tumor_type': 'Tumor', + 'ID': 'C-ALLANT-T001-d_MyFlowCellId', + 'SM': 'C-ALLANT-T001-d', + 'species': 'Human', + 'patient_id': 'C-ALLANT', + 'bait_set': 'IMPACT468_BAITS', + 'igo_id': 'ALN-TEST-01', + 'run_date': None, + 'specimen_type': 'Blood', + 'request_id': 'ALN-REQ-ID'} self.assertEqual(sample, expected_sample) def test_parse_pairs_from_ports1(self): """ Test that pairs are properly constructed from Port objects """ - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json") call_command('loaddata', test_files_fixture, verbosity=0) run_instance = Run.objects.first() ports = run_instance.port_set.all() pairs = parse_pairs_from_ports(ports) - tumor_R2 = FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz")) - turmor_R1 = FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz")) - normal_R2 = FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz")) - normal_R1 = FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz")) + tumor_R2 = FileMetadata.objects.get(file = File.objects.get(file_name = "DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz")) + turmor_R1 = FileMetadata.objects.get(file = File.objects.get(file_name = "DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz")) + normal_R2 = FileMetadata.objects.get(file = File.objects.get(file_name = "DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz")) + normal_R1 = FileMetadata.objects.get(file = File.objects.get(file_name = "DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz")) expected_pairs = [{ 'normal': { @@ -158,129 +117,85 @@ def test_parse_bams_from_ports1(self): """ Test that the 'bams' entries are constructed correctly from the Port objects """ - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json") call_command('loaddata', test_files_fixture, verbosity=0) run_instance = Run.objects.first() ports = run_instance.port_set.all() bams = parse_bams_from_ports(ports) - expected_bams = [[ - File.objects.get(file_name = 's_C_K2902H_P001_d.rg.md.abra.printreads.bam'), - File.objects.get(file_name = 's_C_K2902H_N001_d.rg.md.abra.printreads.bam') - ]] - self.assertEqual(bams, expected_bams) # TODO: need to figure out how this will be handled; need the sample metadata associated with .bam files - - def test_pair_to_cwl1(self): - """ - Test conversion of single pair to base CWL datastructure format - """ - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") - call_command('loaddata', test_files_fixture, verbosity=0) - pair = { - 'normal': { - 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz")), - 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz")) - }, - 'tumor': { - 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz")), - 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz")) - } + expected_bams = { + 'normal_bam' : File.objects.get(file_name = 's_C_ALLANT_N002_d.rg.md.abra.printreads.bam'), + 'normal_bai' : File.objects.get(file_name = 's_C_ALLANT_N002_d.rg.md.abra.printreads.bai'), + 'tumor_bam' : File.objects.get(file_name = 's_C_ALLANT_T001_d.rg.md.abra.printreads.bam'), + 'tumor_bai' : File.objects.get(file_name = 's_C_ALLANT_T001_d.rg.md.abra.printreads.bai') } - - pair_cwl = pair_to_cwl(pair) - - expected_pair_cwl = ({'CN': 'MSKCC', - 'ID': 'C-K2902H-P001-d_H7HCTBBXY', - 'LB': '09670_D_1_1_1_1_1', - 'PL': 'Illumina', - 'PU': 'H7HCTBBXY', - 'R1': {'class': 'File', - 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz'}, - 'R2': {'class': 'File', - 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz'}, - 'SM': 'C-K2902H-P001-d', - 'bait_set': 'IDT_Exome_v1_FP_BAITS', - 'igo_id': '09670_D_1', - 'patient_id': 'C-K2902H', - 'request_id': '09670_D', - 'run_date': '2019-08-15', - 'species': 'Human', - 'specimen_type': 'Biopsy', - 'tumor_type': 'Tumor'}, - {'CN': 'MSKCC', - 'ID': 'C-K2902H-N001-d_H7FKJBBXY', - 'LB': '09670_D_46_1', - 'PL': 'Illumina', - 'PU': 'H7FKJBBXY', - 'R1': {'class': 'File', - 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz'}, - 'R2': {'class': 'File', - 'path': '/ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz'}, - 'SM': 'C-K2902H-N001-d', - 'bait_set': 'IDT_Exome_v1_FP_BAITS', - 'igo_id': '09670_D_46', - 'patient_id': 'C-K2902H', - 'request_id': '09670_D', - 'run_date': '2019-08-19', - 'species': 'Human', - 'specimen_type': 'Blood', - 'tumor_type': 'Normal'}) - self.assertEqual(pair_cwl, expected_pair_cwl) + self.assertEqual(bams, expected_bams) # TODO: need to figure out how this will be handled; need the sample metadata associated with .bam files def test_pair_to_job_data(self): """ Test that a pair dict is correctly converted to Job data for submission """ - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json") call_command('loaddata', test_files_fixture, verbosity=0) pair = { 'normal': { - 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz")), - 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz")) + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz")) }, 'tumor': { - 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz")), - 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz")) + 'R1': FileMetadata.objects.get(file = File.objects.get(file_name = "DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz")), + 'R2': FileMetadata.objects.get(file = File.objects.get(file_name = "DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz")) } } job_data = pair_to_job_data(pair) - - expected_job_data = ({'CN': 'MSKCC', - 'ID': 'C-K2902H-P001-d_H7HCTBBXY', - 'LB': '09670_D_1_1_1_1_1', - 'PL': 'Illumina', - 'PU': 'H7HCTBBXY', - 'R1': {'class': 'File', - 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R1_001.fastq.gz'}, - 'R2': {'class': 'File', - 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0390_BH7HCTBBXY/Project_09670_D/Sample_S16-68609_IGO_09670_D_1/S16-68609_IGO_09670_D_1_S11_R2_001.fastq.gz'}, - 'SM': 'C-K2902H-P001-d', - 'bait_set': 'IDT_Exome_v1_FP_BAITS', - 'igo_id': '09670_D_1', - 'patient_id': 'C-K2902H', - 'request_id': '09670_D', - 'run_date': '2019-08-15', - 'species': 'Human', - 'specimen_type': 'Biopsy', - 'tumor_type': 'Tumor'}, - {'CN': 'MSKCC', - 'ID': 'C-K2902H-N001-d_H7FKJBBXY', - 'LB': '09670_D_46_1', - 'PL': 'Illumina', - 'PU': 'H7FKJBBXY', - 'R1': {'class': 'File', - 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R1_001.fastq.gz'}, - 'R2': {'class': 'File', - 'location': 'juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0391_AH7FKJBBXY/Project_09670_D/Sample_P-0017035-N01-WES_IGO_09670_D_46/P-0017035-N01-WES_IGO_09670_D_46_S12_R2_001.fastq.gz'}, - 'SM': 'C-K2902H-N001-d', - 'bait_set': 'IDT_Exome_v1_FP_BAITS', - 'igo_id': '09670_D_46', - 'patient_id': 'C-K2902H', - 'request_id': '09670_D', - 'run_date': '2019-08-19', - 'species': 'Human', - 'specimen_type': 'Blood', - 'tumor_type': 'Normal'}) + expected_job_data = ({ + "CN": "MSKCC", + "PL": "Illumina", + "PU": "MyFlowCellId", + "LB": "MyLibraryId", + "tumor_type": "Tumor", + "ID": "C-ALLANT-T001-d_MyFlowCellId", + "SM": "C-ALLANT-T001-d", + "species": "Human", + "patient_id": "C-ALLANT", + "bait_set": "IMPACT468_BAITS", + "igo_id": "ALN-TEST-01", + "run_date": None, + "specimen_type": "Blood", + "request_id": "ALN-REQ-ID", + "R1": { + "class": "File", + "location": "juno:///juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R1_001.fastq.gz" + }, + "R2": { + "class": "File", + "location": "juno:///juno/work/pi/prototypes/register_fastqs/DU874145-T/DU874145-T_IGO_00000_TEST_L001_R2_001.fastq.gz" + } + }, + { + "CN": "MSKCC", + "PL": "Illumina", + "PU": "MyFlowCellId", + "LB": "MyLibraryId", + "tumor_type": "Normal", + "ID": "C-ALLANT-N002-d_MyFlowCellId", + "SM": "C-ALLANT-N002-d", + "species": "Human", + "patient_id": "C-ALLANT", + "bait_set": "IMPACT468_BAITS", + "igo_id": "ALN-TEST-02", + "run_date": None, + "specimen_type": "Blood", + "request_id": "ALN-REQ-ID", + "R1": { + "class": "File", + "location": "juno:///juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R1_001.fastq.gz" + }, + "R2": { + "class": "File", + "location": "juno:///juno/work/pi/prototypes/register_fastqs/DU874145-N/DU874145-N_IGO_00000_TEST_L001_R2_001.fastq.gz" + } + }) self.assertEqual(job_data, expected_job_data) @@ -288,7 +203,7 @@ def test_parse_runparams_from_ports1(self): """ Test that runparams are correctly parsed from Port queryset """ - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json") call_command('loaddata', test_files_fixture, verbosity=0) run_instance = Run.objects.first() ports = run_instance.port_set.all() @@ -296,10 +211,17 @@ def test_parse_runparams_from_ports1(self): expected_runparams = {'genome': 'GRCh37', 'pi': 'NA', 'pi_email': 'NA', - 'project_prefix': '09670_D', - 'scripts_bin': '/usr/bin'} + 'project_prefix': 'ALN-REQ-ID', + 'scripts_bin': '/usr/bin', + 'assay': 'IMPACT468_BAITS'} self.assertEqual(runparams, expected_runparams) + def test_get_baits_and_targets1(self): + """ + Test that give a certain assay label, the correct one is returned + """ + self.assertEqual(get_baits_and_targets("IMPACT468_BAITS"), "IMPACT468_b37") + def test_get_db_files(self): """ Test that db_files are returned correctly @@ -358,9 +280,9 @@ def test_build_inputs_from_run_and_ports1(self): Test generation of Roslin QC input from Roslin pipeline output Run and Port instances """ # load test pipeline Run output fixtures - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json") call_command('loaddata', test_files_fixture, verbosity=0) - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "dfefc47b-3ee4-4867-890f-9bab87c7f53f.run.json") call_command('loaddata', test_files_fixture, verbosity=0) run_queryset = Run.objects.all() @@ -368,8 +290,8 @@ def test_build_inputs_from_run_and_ports1(self): qc_input = build_inputs_from_runs(run_queryset) # print(">>> printing qc_input to file") # print(json.dumps(qc_input, indent = 4), file = open("qc_input.json", 'w')) - # self.assertTrue(False) - # TODO: how to output format? + + # TODO: how to test output format? self.assertEqual(len(qc_input['pairs']), 2) self.assertEqual(len(qc_input['pairs'][0]), 2) self.assertEqual(len(qc_input['bams']), 2) @@ -384,18 +306,18 @@ def test_load_extra_fixtures(self): self.assertEqual(len(File.objects.all()), 0) self.assertEqual(len(FileMetadata.objects.all()), 0) - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json") call_command('loaddata', test_files_fixture, verbosity=0) self.assertEqual(len(Run.objects.all()), 1) - self.assertEqual(len(Port.objects.all()), 47) - self.assertEqual(len(File.objects.all()), 121) - self.assertEqual(len(FileMetadata.objects.all()), 121) + self.assertEqual(len(Port.objects.all()), 51) + self.assertEqual(len(File.objects.all()), 114) + self.assertEqual(len(FileMetadata.objects.all()), 114) - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "daa13d24-50ea-11ea-b9c7-ac1f6b453620.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "dfefc47b-3ee4-4867-890f-9bab87c7f53f.run.json") call_command('loaddata', test_files_fixture, verbosity=0) self.assertEqual(len(Run.objects.all()), 2) - self.assertEqual(len(Port.objects.all()), 94) - self.assertEqual(len(File.objects.all()), 242) - self.assertEqual(len(FileMetadata.objects.all()), 242) + self.assertEqual(len(Port.objects.all()), 102) + self.assertEqual(len(File.objects.all()), 168) + self.assertEqual(len(FileMetadata.objects.all()), 168) diff --git a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py index b33440083..a439063d5 100644 --- a/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py +++ b/runner/tests/operator/roslin_qc_operator/test_roslin_qc_operator.py @@ -43,17 +43,18 @@ def test_direct_operator_creation(self, submit_job): Test direct Operator instantiation without Operator Factory and try to create valid jobs """ # self.maxDiff = None - test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") + test_files_fixture = os.path.join(settings.FIXTURES_DIR, "runs", "aa0694f1-0109-4205-a6b2-63e3e1d7c0a2.run.json") + # test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "ca18b090-03ad-4bef-acd3-52600f8e62eb.run.full.json") call_command('loaddata', test_files_fixture, verbosity=0) test_files_fixture = os.path.join(settings.TEST_FIXTURE_DIR, "roslin_reference_files.json") call_command('loaddata', test_files_fixture, verbosity=0) # create the operator instance roslin_qc_model = Operator.objects.get(slug="roslin-qc") - operator = RoslinQcOperator(roslin_qc_model, run_ids = ['ca18b090-03ad-4bef-acd3-52600f8e62eb']) + operator = RoslinQcOperator(roslin_qc_model, run_ids = ['aa0694f1-0109-4205-a6b2-63e3e1d7c0a2']) # check its attributes - self.assertEqual(operator.run_ids, ['ca18b090-03ad-4bef-acd3-52600f8e62eb']) + self.assertEqual(operator.run_ids, ['aa0694f1-0109-4205-a6b2-63e3e1d7c0a2']) self.assertEqual(operator.get_pipeline_id(), "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a") # create the data for the operator run @@ -75,7 +76,7 @@ def test_direct_operator_creation(self, submit_job): 'app': "9b7f2ac8-03a5-4c44-ae87-1d9f6500d19a", 'inputs': input_data, 'name': "foo name", - 'tags': {'run_ids':['ca18b090-03ad-4bef-acd3-52600f8e62eb']}, + 'tags': {'run_ids':['aa0694f1-0109-4205-a6b2-63e3e1d7c0a2']}, 'output_metadata': output_metadata } self.assertEqual(serializer_data, expected_serializer_data) diff --git a/scripts/dump_db_fixtures.py b/scripts/dump_db_fixtures.py index 02cced8b0..79b7e88d9 100755 --- a/scripts/dump_db_fixtures.py +++ b/scripts/dump_db_fixtures.py @@ -46,7 +46,7 @@ os.environ.setdefault("DJANGO_SETTINGS_MODULE", "beagle.settings") django.setup() from file_system.models import File, FileMetadata, FileGroup, FileType -from runner.models import Run, RunStatus, Port, PortType, Pipeline +from runner.models import Run, RunStatus, Port, PortType, Pipeline, OperatorRun sys.path.pop(0) def get_file_filemetadata_from_port(port_instance): @@ -94,6 +94,7 @@ def dump_run(**kwargs): output_port_filemetadata_input_file = "{}.run.port_filemetadata.input.json".format(runID) output_port_file_output_file = "{}.run.port_file.output.json".format(runID) output_port_filemetadata_output_file = "{}.run.port_filemetadata.output.json".format(runID) + output_operator_run_file = "{}.run.operator_run.json".format(runID) all_data = [] input_files = [] @@ -104,6 +105,8 @@ def dump_run(**kwargs): # get the parent Run instance run_instance = Run.objects.get(id = runID) + operator_run_instance = run_instance.operator_run + # get the Run input and output Port instances input_port_queryset = run_instance.port_set.filter(port_type=PortType.INPUT) output_port_queryset = run_instance.port_set.filter(port_type=PortType.OUTPUT) @@ -125,6 +128,7 @@ def dump_run(**kwargs): # save each set of items to individual files by default if onefile == False: print(json.dumps(json.loads(serializers.serialize('json', [run_instance])), indent=4), file = open(output_run_file, "w")) + print(json.dumps(json.loads(serializers.serialize('json', [operator_run_instance])), indent=4), file = open(output_operator_run_file, "w")) print(json.dumps(json.loads(serializers.serialize('json', input_port_queryset.all())), indent=4), file = open(output_port_input_file, "w")) print(json.dumps(json.loads(serializers.serialize('json', output_port_queryset.all())), indent=4), file = open(output_port_output_file, "w")) @@ -137,6 +141,7 @@ def dump_run(**kwargs): # save all items to a single file if onefile == True: all_data.append(run_instance) + all_data.append(operator_run_instance) for item in input_port_queryset: all_data.append(item) for item in output_port_queryset: