diff --git a/CHANGELOG.md b/CHANGELOG.md
index bd9cb42..4b635d1 100644
--- a/CHANGELOG.md
+++ b/CHANGELOG.md
@@ -3,14 +3,20 @@
The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/)
and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html).
-## v1.0dev - [date]
+## 1.0.0 2024-06-19
-Initial release of nf-core/demo, created with the [nf-core](https://nf-co.re/) template.
+### Credits
+
+Special thanks to the following for their reviews and assistance:
+
+- [Maxime Garcia](https://github.com/maxulysse)
+- [Friederike Hanssen](https://github.com/FriederikeHanssen)
### `Added`
-### `Fixed`
+- `nf-core/seqtk/trim` module
+- `skip_trim` parameter
-### `Dependencies`
+## v1.0dev - 2024-05-5
-### `Deprecated`
+Initial release of nf-core/demo, created with the [nf-core](https://nf-co.re/) template.
diff --git a/CITATIONS.md b/CITATIONS.md
index b5d0459..934aa07 100644
--- a/CITATIONS.md
+++ b/CITATIONS.md
@@ -14,9 +14,7 @@
> Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online].
-- [fastp](https://www.ncbi.nlm.nih.gov/pubmed/30423086/)
-
- > Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018 Sep 1;34(17):i884-i890. doi: 10.1093/bioinformatics/bty560. PubMed PMID: 30423086; PubMed Central PMCID: PMC6129281.
+- [seqtk](https://github.com/lh3/seqtk)
- [MultiQC](https://pubmed.ncbi.nlm.nih.gov/27312411/)
diff --git a/README.md b/README.md
index 9ac9041..796989d 100644
--- a/README.md
+++ b/README.md
@@ -24,7 +24,7 @@

1. Read QC ([`FASTQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/))
-2. Adapter and quality trimming ([`FASTP`](https://github.com/OpenGene/fastp))
+2. Adapter and quality trimming ([`SEQTK_TRIM`](https://github.com/lh3/seqtk))
3. Present QC for raw reads ([`MULTIQC`](http://multiqc.info/))
## Usage
diff --git a/assets/nf-core-demo_logo_light.png b/assets/nf-core-demo_logo_light.png
index 0ef9fa5..2543e50 100644
Binary files a/assets/nf-core-demo_logo_light.png and b/assets/nf-core-demo_logo_light.png differ
diff --git a/conf/modules.config b/conf/modules.config
index a689cbd..189cef9 100644
--- a/conf/modules.config
+++ b/conf/modules.config
@@ -28,11 +28,11 @@ process {
}
- withName: 'FASTP' {
+ withName: 'SEQTK_TRIM' {
publishDir = [
- path: { "${params.outdir}/fastp/${meta.id}" },
+ path: { "${params.outdir}/fq/${meta.id}" },
mode: params.publish_dir_mode,
- pattern: "*.{html,json,log}"
+ pattern: "*.{fastq.gz}"
]
}
diff --git a/conf/test.config b/conf/test.config
index 4bbce52..5bff1d1 100644
--- a/conf/test.config
+++ b/conf/test.config
@@ -22,6 +22,4 @@ params {
// Input data
input = params.pipelines_testdata_base_path + 'viralrecon/samplesheet/samplesheet_test_illumina_amplicon.csv'
- // Genome references
- genome = 'R64-1-1'
}
diff --git a/conf/test_full.config b/conf/test_full.config
index 1d82110..6346afd 100644
--- a/conf/test_full.config
+++ b/conf/test_full.config
@@ -14,9 +14,7 @@ params {
config_profile_name = 'Full test profile'
config_profile_description = 'Full test dataset to check pipeline function'
- // Input data for full size test
- input = params.pipelines_testdata_base_path + 'viralrecon/samplesheet/samplesheet_full_illumina_amplicon.csv'
+ // Input data
+ input = 'https://raw.githubusercontent.com/nf-core/test-datasets/viralrecon/samplesheet/samplesheet_test_illumina_amplicon.csv'
- // Genome references
- genome = 'R64-1-1'
}
diff --git a/docs/images/nf-core-demo-subway.png b/docs/images/nf-core-demo-subway.png
index 1a2ebcd..e7914fe 100644
Binary files a/docs/images/nf-core-demo-subway.png and b/docs/images/nf-core-demo-subway.png differ
diff --git a/docs/images/nf-core-demo-subway.svg b/docs/images/nf-core-demo-subway.svg
index 90706b8..2b8c2ab 100644
--- a/docs/images/nf-core-demo-subway.svg
+++ b/docs/images/nf-core-demo-subway.svg
@@ -1,33 +1,29 @@
diff --git a/docs/images/nf-core-demo_logo_dark.png b/docs/images/nf-core-demo_logo_dark.png
index 5e22400..44f9995 100644
Binary files a/docs/images/nf-core-demo_logo_dark.png and b/docs/images/nf-core-demo_logo_dark.png differ
diff --git a/docs/images/nf-core-demo_logo_light.png b/docs/images/nf-core-demo_logo_light.png
index c9d0c4b..b945f8c 100644
Binary files a/docs/images/nf-core-demo_logo_light.png and b/docs/images/nf-core-demo_logo_light.png differ
diff --git a/docs/output.md b/docs/output.md
index f8f0f90..411fdf5 100644
--- a/docs/output.md
+++ b/docs/output.md
@@ -11,7 +11,7 @@ The directories listed below will be created in the results directory after the
The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes data using the following steps:
- [FastQC](#fastqc) - Raw read QC
-- [fastp](#fastp) - Adapter and quality trimming
+- [seqtk](#seqtk) - Processing sequences in the FASTA or FASTQ format.
- [MultiQC](#multiqc) - Aggregate report describing results and QC from the whole pipeline
- [Pipeline information](#pipeline-information) - Report metrics generated during the workflow execution
@@ -38,20 +38,17 @@ The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes d
The FastQC plots displayed in the MultiQC report shows _untrimmed_ reads. They may contain adapter sequence and potentially regions with low quality.
:::
-### fastp
+### seqtk
Output files
-- `fastp/`
- - `*.fastp.html`: Trimming report in html format.
- - `*.fastp.json`: Trimming report in json format.
- - `*.fastp.log`: Trimming log file.
- - `*.fastq.gz`: If `--save_trimmed` is specified, FastQ files **after** adapter trimming will be placed in this directory.
+- `fq/`
+ - `*.fastq.gz`: Trimmed FASTQ files.
-[fastp](https://github.com/OpenGene/fastp) is a tool designed to provide fast, all-in-one preprocessing for FastQ files. It has been developed in C++ with multithreading support to achieve higher performance. fastp can be used in this pipeline for standard adapter trimming and quality filtering.
+[seqtk](https://github.com/lh3/seqtk) is a fast and lightweight tool for processing sequences in the FASTA or FASTQ format. It seamlessly parses both FASTA and FASTQ files which can also be optionally compressed by gzip.
### MultiQC
diff --git a/modules.json b/modules.json
index a1e9750..67933c1 100644
--- a/modules.json
+++ b/modules.json
@@ -5,11 +5,6 @@
"https://github.com/nf-core/modules.git": {
"modules": {
"nf-core": {
- "fastp": {
- "branch": "master",
- "git_sha": "95cf5fe0194c7bf5cb0e3027a2eb7e7c89385080",
- "installed_by": ["modules"]
- },
"fastqc": {
"branch": "master",
"git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd",
@@ -19,6 +14,11 @@
"branch": "master",
"git_sha": "b7ebe95761cd389603f9cc0e0dc384c0f663815a",
"installed_by": ["modules"]
+ },
+ "seqtk/trim": {
+ "branch": "master",
+ "git_sha": "71c669747731cbc360dc220069c9f83015558c07",
+ "installed_by": ["modules"]
}
}
},
diff --git a/modules/nf-core/fastp/main.nf b/modules/nf-core/fastp/main.nf
deleted file mode 100644
index 4fc19b7..0000000
--- a/modules/nf-core/fastp/main.nf
+++ /dev/null
@@ -1,120 +0,0 @@
-process FASTP {
- tag "$meta.id"
- label 'process_medium'
-
- conda "${moduleDir}/environment.yml"
- container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/fastp:0.23.4--h5f740d0_0' :
- 'biocontainers/fastp:0.23.4--h5f740d0_0' }"
-
- input:
- tuple val(meta), path(reads)
- path adapter_fasta
- val save_trimmed_fail
- val save_merged
-
- output:
- tuple val(meta), path('*.fastp.fastq.gz') , optional:true, emit: reads
- tuple val(meta), path('*.json') , emit: json
- tuple val(meta), path('*.html') , emit: html
- tuple val(meta), path('*.log') , emit: log
- path "versions.yml" , emit: versions
- tuple val(meta), path('*.fail.fastq.gz') , optional:true, emit: reads_fail
- tuple val(meta), path('*.merged.fastq.gz'), optional:true, emit: reads_merged
-
- when:
- task.ext.when == null || task.ext.when
-
- script:
- def args = task.ext.args ?: ''
- def prefix = task.ext.prefix ?: "${meta.id}"
- def adapter_list = adapter_fasta ? "--adapter_fasta ${adapter_fasta}" : ""
- def fail_fastq = save_trimmed_fail && meta.single_end ? "--failed_out ${prefix}.fail.fastq.gz" : save_trimmed_fail && !meta.single_end ? "--failed_out ${prefix}.paired.fail.fastq.gz --unpaired1 ${prefix}_1.fail.fastq.gz --unpaired2 ${prefix}_2.fail.fastq.gz" : ''
- // Added soft-links to original fastqs for consistent naming in MultiQC
- // Use single ended for interleaved. Add --interleaved_in in config.
- if ( task.ext.args?.contains('--interleaved_in') ) {
- """
- [ ! -f ${prefix}.fastq.gz ] && ln -sf $reads ${prefix}.fastq.gz
-
- fastp \\
- --stdout \\
- --in1 ${prefix}.fastq.gz \\
- --thread $task.cpus \\
- --json ${prefix}.fastp.json \\
- --html ${prefix}.fastp.html \\
- $adapter_list \\
- $fail_fastq \\
- $args \\
- 2> >(tee ${prefix}.fastp.log >&2) \\
- | gzip -c > ${prefix}.fastp.fastq.gz
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g")
- END_VERSIONS
- """
- } else if (meta.single_end) {
- """
- [ ! -f ${prefix}.fastq.gz ] && ln -sf $reads ${prefix}.fastq.gz
-
- fastp \\
- --in1 ${prefix}.fastq.gz \\
- --out1 ${prefix}.fastp.fastq.gz \\
- --thread $task.cpus \\
- --json ${prefix}.fastp.json \\
- --html ${prefix}.fastp.html \\
- $adapter_list \\
- $fail_fastq \\
- $args \\
- 2> >(tee ${prefix}.fastp.log >&2)
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g")
- END_VERSIONS
- """
- } else {
- def merge_fastq = save_merged ? "-m --merged_out ${prefix}.merged.fastq.gz" : ''
- """
- [ ! -f ${prefix}_1.fastq.gz ] && ln -sf ${reads[0]} ${prefix}_1.fastq.gz
- [ ! -f ${prefix}_2.fastq.gz ] && ln -sf ${reads[1]} ${prefix}_2.fastq.gz
- fastp \\
- --in1 ${prefix}_1.fastq.gz \\
- --in2 ${prefix}_2.fastq.gz \\
- --out1 ${prefix}_1.fastp.fastq.gz \\
- --out2 ${prefix}_2.fastp.fastq.gz \\
- --json ${prefix}.fastp.json \\
- --html ${prefix}.fastp.html \\
- $adapter_list \\
- $fail_fastq \\
- $merge_fastq \\
- --thread $task.cpus \\
- --detect_adapter_for_pe \\
- $args \\
- 2> >(tee ${prefix}.fastp.log >&2)
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g")
- END_VERSIONS
- """
- }
-
- stub:
- def prefix = task.ext.prefix ?: "${meta.id}"
- def is_single_output = task.ext.args?.contains('--interleaved_in') || meta.single_end
- def touch_reads = is_single_output ? "${prefix}.fastp.fastq.gz" : "${prefix}_1.fastp.fastq.gz ${prefix}_2.fastp.fastq.gz"
- def touch_merged = (!is_single_output && save_merged) ? "touch ${prefix}.merged.fastq.gz" : ""
- """
- touch $touch_reads
- touch "${prefix}.fastp.json"
- touch "${prefix}.fastp.html"
- touch "${prefix}.fastp.log"
- $touch_merged
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- fastp: \$(fastp --version 2>&1 | sed -e "s/fastp //g")
- END_VERSIONS
- """
-}
diff --git a/modules/nf-core/fastp/meta.yml b/modules/nf-core/fastp/meta.yml
deleted file mode 100644
index c22a16a..0000000
--- a/modules/nf-core/fastp/meta.yml
+++ /dev/null
@@ -1,75 +0,0 @@
-name: fastp
-description: Perform adapter/quality trimming on sequencing reads
-keywords:
- - trimming
- - quality control
- - fastq
-tools:
- - fastp:
- description: |
- A tool designed to provide fast all-in-one preprocessing for FastQ files. This tool is developed in C++ with multithreading supported to afford high performance.
- documentation: https://github.com/OpenGene/fastp
- doi: 10.1093/bioinformatics/bty560
- licence: ["MIT"]
-input:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information. Use 'single_end: true' to specify single ended or interleaved FASTQs. Use 'single_end: false' for paired-end reads.
- e.g. [ id:'test', single_end:false ]
- - reads:
- type: file
- description: |
- List of input FastQ files of size 1 and 2 for single-end and paired-end data,
- respectively. If you wish to run interleaved paired-end data, supply as single-end data
- but with `--interleaved_in` in your `modules.conf`'s `ext.args` for the module.
- - adapter_fasta:
- type: file
- description: File in FASTA format containing possible adapters to remove.
- pattern: "*.{fasta,fna,fas,fa}"
- - save_trimmed_fail:
- type: boolean
- description: Specify true to save files that failed to pass trimming thresholds ending in `*.fail.fastq.gz`
- - save_merged:
- type: boolean
- description: Specify true to save all merged reads to the a file ending in `*.merged.fastq.gz`
-output:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - reads:
- type: file
- description: The trimmed/modified/unmerged fastq reads
- pattern: "*fastp.fastq.gz"
- - json:
- type: file
- description: Results in JSON format
- pattern: "*.json"
- - html:
- type: file
- description: Results in HTML format
- pattern: "*.html"
- - log:
- type: file
- description: fastq log file
- pattern: "*.log"
- - versions:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
- - reads_fail:
- type: file
- description: Reads the failed the preprocessing
- pattern: "*fail.fastq.gz"
- - reads_merged:
- type: file
- description: Reads that were successfully merged
- pattern: "*.{merged.fastq.gz}"
-authors:
- - "@drpatelh"
- - "@kevinmenden"
-maintainers:
- - "@drpatelh"
- - "@kevinmenden"
diff --git a/modules/nf-core/fastp/tests/main.nf.test b/modules/nf-core/fastp/tests/main.nf.test
deleted file mode 100644
index 6f1f489..0000000
--- a/modules/nf-core/fastp/tests/main.nf.test
+++ /dev/null
@@ -1,725 +0,0 @@
-nextflow_process {
-
- name "Test Process FASTP"
- script "../main.nf"
- process "FASTP"
- tag "modules"
- tag "modules_nfcore"
- tag "fastp"
-
- test("test_fastp_single_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = false
-
- input[0] = Channel.of([
- [ id:'test', single_end:true ],
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases:
12.922000 K (92.984097%)",
- "single end (151 cycles)" ]
- def log_text = [ "Q20 bases: 12922(92.9841%)",
- "reads passed filter: 99" ]
- def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { assert snapshot(process.out.json).match("test_fastp_single_end_json") },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- {
- assert snapshot(
- (
- [process.out.reads[0][0].toString()] + // meta
- process.out.reads.collect { file(it[1]).getName() } +
- process.out.json.collect { file(it[1]).getName() } +
- process.out.html.collect { file(it[1]).getName() } +
- process.out.log.collect { file(it[1]).getName() } +
- process.out.reads_fail.collect { file(it[1]).getName() } +
- process.out.reads_merged.collect { file(it[1]).getName() }
- ).sort()
- ).match("test_fastp_single_end-_match")
- },
- { assert snapshot(process.out.versions).match("versions_single_end") }
- )
- }
- }
-
- test("test_fastp_single_end-stub") {
-
- options '-stub'
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = false
-
- input[0] = Channel.of([
- [ id:'test', single_end:true ],
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
-
- assertAll(
- { assert process.success },
- {
- assert snapshot(
- (
- [process.out.reads[0][0].toString()] + // meta
- process.out.reads.collect { file(it[1]).getName() } +
- process.out.json.collect { file(it[1]).getName() } +
- process.out.html.collect { file(it[1]).getName() } +
- process.out.log.collect { file(it[1]).getName() } +
- process.out.reads_fail.collect { file(it[1]).getName() } +
- process.out.reads_merged.collect { file(it[1]).getName() }
- ).sort()
- ).match("test_fastp_single_end-for_stub_match")
- },
- { assert snapshot(process.out.versions).match("versions_single_end_stub") }
- )
- }
- }
-
- test("test_fastp_paired_end") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = false
-
- input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases: | 25.719000 K (93.033098%)",
- "The input has little adapter percentage (~0.000000%), probably it's trimmed before."]
- def log_text = [ "No adapter detected for read1",
- "Q30 bases: 12281(88.3716%)"]
- def json_text = ['"passed_filter_reads": 198']
- def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { json_text.each { json_part ->
- { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
- }
- },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- {
- assert snapshot(
- (
- [process.out.reads[0][0].toString()] + // meta
- process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
- process.out.json.collect { file(it[1]).getName() } +
- process.out.html.collect { file(it[1]).getName() } +
- process.out.log.collect { file(it[1]).getName() } +
- process.out.reads_fail.collect { file(it[1]).getName() } +
- process.out.reads_merged.collect { file(it[1]).getName() }
- ).sort()
- ).match("test_fastp_paired_end_match")
- },
- { assert snapshot(process.out.versions).match("versions_paired_end") }
- )
- }
- }
-
- test("test_fastp_paired_end-stub") {
-
- options '-stub'
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = false
-
- input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- {
- assert snapshot(
- (
- [process.out.reads[0][0].toString()] + // meta
- process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
- process.out.json.collect { file(it[1]).getName() } +
- process.out.html.collect { file(it[1]).getName() } +
- process.out.log.collect { file(it[1]).getName() } +
- process.out.reads_fail.collect { file(it[1]).getName() } +
- process.out.reads_merged.collect { file(it[1]).getName() }
- ).sort()
- ).match("test_fastp_paired_end-for_stub_match")
- },
- { assert snapshot(process.out.versions).match("versions_paired_end-stub") }
- )
- }
- }
-
- test("fastp test_fastp_interleaved") {
-
- config './nextflow.interleaved.config'
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = false
-
- input[0] = Channel.of([
- [ id:'test', single_end:true ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases: | 25.719000 K (93.033098%)",
- "paired end (151 cycles + 151 cycles)"]
- def log_text = [ "Q20 bases: 12922(92.9841%)",
- "reads passed filter: 162"]
- def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- {
- assert snapshot(
- (
- [process.out.reads[0][0].toString()] + // meta
- process.out.reads.collect { file(it[1]).getName() } +
- process.out.json.collect { file(it[1]).getName() } +
- process.out.html.collect { file(it[1]).getName() } +
- process.out.log.collect { file(it[1]).getName() } +
- process.out.reads_fail.collect { file(it[1]).getName() } +
- process.out.reads_merged.collect { file(it[1]).getName() }
- ).sort()
- ).match("test_fastp_interleaved-_match")
- },
- { assert snapshot(process.out.versions).match("versions_interleaved") }
- )
- }
- }
-
- test("fastp test_fastp_interleaved-stub") {
-
- options '-stub'
-
- config './nextflow.interleaved.config'
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = false
-
- input[0] = Channel.of([
- [ id:'test', single_end:true ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- {
- assert snapshot(
- (
- [process.out.reads[0][0].toString()] + // meta
- process.out.reads.collect { file(it[1]).getName() } +
- process.out.json.collect { file(it[1]).getName() } +
- process.out.html.collect { file(it[1]).getName() } +
- process.out.log.collect { file(it[1]).getName() } +
- process.out.reads_fail.collect { file(it[1]).getName() } +
- process.out.reads_merged.collect { file(it[1]).getName() }
- ).sort()
- ).match("test_fastp_interleaved-for_stub_match")
- },
- { assert snapshot(process.out.versions).match("versions_interleaved-stub") }
- )
- }
- }
-
- test("test_fastp_single_end_trim_fail") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = true
- save_merged = false
-
- input[0] = Channel.of([
- [ id:'test', single_end:true ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases: | 12.922000 K (92.984097%)",
- "single end (151 cycles)"]
- def log_text = [ "Q20 bases: 12922(92.9841%)",
- "reads passed filter: 99" ]
- def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
- }
- },
- { failed_read_lines.each { failed_read_line ->
- { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions_single_end_trim_fail") }
- )
- }
- }
-
- test("test_fastp_paired_end_trim_fail") {
-
- config './nextflow.save_failed.config'
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = true
- save_merged = false
-
- input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ "Q20 bases: | 25.719000 K (93.033098%)",
- "The input has little adapter percentage (~0.000000%), probably it's trimmed before."]
- def log_text = [ "No adapter detected for read1",
- "Q30 bases: 12281(88.3716%)"]
- def json_text = ['"passed_filter_reads": 162']
- def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { failed_read2_lines.each { failed_read2_line ->
- { assert path(process.out.reads_fail.get(0).get(1).get(2)).linesGzip.contains(failed_read2_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { json_text.each { json_part ->
- { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
- }
- },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions_paired_end_trim_fail") }
- )
- }
- }
-
- test("test_fastp_paired_end_merged") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = true
- input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ ""]
- def log_text = [ "Merged and filtered:",
- "total reads: 75",
- "total bases: 13683"]
- def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683']
- def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1",
- "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC",
- "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { read_merged_lines.each { read_merged_line ->
- { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { json_text.each { json_part ->
- { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
- }
- },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- {
- assert snapshot(
- (
- [process.out.reads[0][0].toString()] + // meta
- process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
- process.out.json.collect { file(it[1]).getName() } +
- process.out.html.collect { file(it[1]).getName() } +
- process.out.log.collect { file(it[1]).getName() } +
- process.out.reads_fail.collect { file(it[1]).getName() } +
- process.out.reads_merged.collect { file(it[1]).getName() }
- ).sort()
- ).match("test_fastp_paired_end_merged_match")
- },
- { assert snapshot(process.out.versions).match("versions_paired_end_merged") }
- )
- }
- }
-
- test("test_fastp_paired_end_merged-stub") {
-
- options '-stub'
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = []
- save_trimmed_fail = false
- save_merged = true
-
- input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- {
- assert snapshot(
- (
- [process.out.reads[0][0].toString()] + // meta
- process.out.reads.collect { it[1].collect { item -> file(item).getName() } } +
- process.out.json.collect { file(it[1]).getName() } +
- process.out.html.collect { file(it[1]).getName() } +
- process.out.log.collect { file(it[1]).getName() } +
- process.out.reads_fail.collect { file(it[1]).getName() } +
- process.out.reads_merged.collect { file(it[1]).getName() }
- ).sort()
- ).match("test_fastp_paired_end_merged-for_stub_match")
- },
- { assert snapshot(process.out.versions).match("versions_paired_end_merged_stub") }
- )
- }
- }
-
- test("test_fastp_paired_end_merged_adapterlist") {
-
- when {
- params {
- outdir = "$outputDir"
- }
- process {
- """
- adapter_fasta = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ])
- save_trimmed_fail = false
- save_merged = true
-
- input[0] = Channel.of([
- [ id:'test', single_end:false ], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
- ])
- input[1] = adapter_fasta
- input[2] = save_trimmed_fail
- input[3] = save_merged
- """
- }
- }
-
- then {
- def html_text = [ ""]
- def log_text = [ "Merged and filtered:",
- "total reads: 75",
- "total bases: 13683"]
- def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"]
- def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1",
- "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC",
- "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { read_merged_lines.each { read_merged_line ->
- { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) }
- }
- },
- { html_text.each { html_part ->
- { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) }
- }
- },
- { json_text.each { json_part ->
- { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) }
- }
- },
- { log_text.each { log_part ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) }
- }
- },
- { assert snapshot(process.out.versions).match("versions_paired_end_merged_adapterlist") }
- )
- }
- }
-}
diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap
deleted file mode 100644
index 3e87628..0000000
--- a/modules/nf-core/fastp/tests/main.nf.test.snap
+++ /dev/null
@@ -1,330 +0,0 @@
-{
- "fastp test_fastp_interleaved_json": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastp.json:md5,b24e0624df5cc0b11cd5ba21b726fb22"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-03-18T16:19:15.063001"
- },
- "test_fastp_paired_end_merged-for_stub_match": {
- "content": [
- [
- [
- "test_1.fastp.fastq.gz",
- "test_2.fastp.fastq.gz"
- ],
- "test.fastp.html",
- "test.fastp.json",
- "test.fastp.log",
- "test.merged.fastq.gz",
- "{id=test, single_end=false}"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T18:10:13.467574"
- },
- "versions_interleaved": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:56:24.615634793"
- },
- "test_fastp_single_end_json": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-03-18T16:18:43.526412"
- },
- "versions_paired_end": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:55:42.333545689"
- },
- "test_fastp_paired_end_match": {
- "content": [
- [
- [
- "test_1.fastp.fastq.gz",
- "test_2.fastp.fastq.gz"
- ],
- "test.fastp.html",
- "test.fastp.json",
- "test.fastp.log",
- "{id=test, single_end=false}"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T12:03:06.431833729"
- },
- "test_fastp_interleaved-_match": {
- "content": [
- [
- "test.fastp.fastq.gz",
- "test.fastp.html",
- "test.fastp.json",
- "test.fastp.log",
- "{id=test, single_end=true}"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-03-18T16:19:15.111894"
- },
- "test_fastp_paired_end_merged_match": {
- "content": [
- [
- [
- "test_1.fastp.fastq.gz",
- "test_2.fastp.fastq.gz"
- ],
- "test.fastp.html",
- "test.fastp.json",
- "test.fastp.log",
- "test.merged.fastq.gz",
- "{id=test, single_end=false}"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T12:08:44.496251446"
- },
- "versions_single_end_stub": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:55:27.354051299"
- },
- "versions_interleaved-stub": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:56:46.535528418"
- },
- "versions_single_end_trim_fail": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:59:03.724591407"
- },
- "test_fastp_paired_end-for_stub_match": {
- "content": [
- [
- [
- "test_1.fastp.fastq.gz",
- "test_2.fastp.fastq.gz"
- ],
- "test.fastp.html",
- "test.fastp.json",
- "test.fastp.log",
- "{id=test, single_end=false}"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T18:07:15.398827"
- },
- "versions_paired_end-stub": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:56:06.50017282"
- },
- "versions_single_end": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:55:07.67921647"
- },
- "versions_paired_end_merged_stub": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:59:47.350653154"
- },
- "test_fastp_interleaved-for_stub_match": {
- "content": [
- [
- "test.fastp.fastq.gz",
- "test.fastp.html",
- "test.fastp.json",
- "test.fastp.log",
- "{id=test, single_end=true}"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T18:08:06.127974"
- },
- "versions_paired_end_trim_fail": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:59:18.140484878"
- },
- "test_fastp_single_end-for_stub_match": {
- "content": [
- [
- "test.fastp.fastq.gz",
- "test.fastp.html",
- "test.fastp.json",
- "test.fastp.log",
- "{id=test, single_end=true}"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T18:06:00.244202"
- },
- "test_fastp_single_end-_match": {
- "content": [
- [
- "test.fastp.fastq.gz",
- "test.fastp.html",
- "test.fastp.json",
- "test.fastp.log",
- "{id=test, single_end=true}"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-03-18T16:18:43.580336"
- },
- "versions_paired_end_merged_adapterlist": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T12:05:37.845370554"
- },
- "versions_paired_end_merged": {
- "content": [
- [
- "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02"
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-02-01T11:59:32.860543858"
- },
- "test_fastp_single_end_trim_fail_json": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T18:08:41.942317"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/fastp/tests/nextflow.interleaved.config b/modules/nf-core/fastp/tests/nextflow.interleaved.config
deleted file mode 100644
index 4be8dbd..0000000
--- a/modules/nf-core/fastp/tests/nextflow.interleaved.config
+++ /dev/null
@@ -1,5 +0,0 @@
-process {
- withName: FASTP {
- ext.args = "--interleaved_in -e 30"
- }
-}
diff --git a/modules/nf-core/fastp/tests/nextflow.save_failed.config b/modules/nf-core/fastp/tests/nextflow.save_failed.config
deleted file mode 100644
index 53b61b0..0000000
--- a/modules/nf-core/fastp/tests/nextflow.save_failed.config
+++ /dev/null
@@ -1,5 +0,0 @@
-process {
- withName: FASTP {
- ext.args = "-e 30"
- }
-}
diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml
deleted file mode 100644
index c1afcce..0000000
--- a/modules/nf-core/fastp/tests/tags.yml
+++ /dev/null
@@ -1,2 +0,0 @@
-fastp:
- - modules/nf-core/fastp/**
diff --git a/modules/nf-core/fastp/environment.yml b/modules/nf-core/seqtk/trim/environment.yml
similarity index 61%
rename from modules/nf-core/fastp/environment.yml
rename to modules/nf-core/seqtk/trim/environment.yml
index 70389e6..389a3a9 100644
--- a/modules/nf-core/fastp/environment.yml
+++ b/modules/nf-core/seqtk/trim/environment.yml
@@ -1,7 +1,7 @@
-name: fastp
+name: seqtk_trim
channels:
- conda-forge
- bioconda
- defaults
dependencies:
- - bioconda::fastp=0.23.4
+ - bioconda::seqtk=1.4
diff --git a/modules/nf-core/seqtk/trim/main.nf b/modules/nf-core/seqtk/trim/main.nf
new file mode 100644
index 0000000..0f7e4d7
--- /dev/null
+++ b/modules/nf-core/seqtk/trim/main.nf
@@ -0,0 +1,38 @@
+process SEQTK_TRIM {
+ tag "$meta.id"
+ label 'process_low'
+
+ conda "${moduleDir}/environment.yml"
+ container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+ 'https://depot.galaxyproject.org/singularity/seqtk:1.4--he4a0461_1' :
+ 'biocontainers/seqtk:1.4--he4a0461_1' }"
+
+ input:
+ tuple val(meta), path(reads)
+
+ output:
+ tuple val(meta), path("*.fastq.gz"), emit: reads
+ path "versions.yml" , emit: versions
+
+ when:
+ task.ext.when == null || task.ext.when
+
+ script:
+ def args = task.ext.args ?: ''
+ def prefix = task.ext.prefix ?: "${meta.id}"
+ """
+ printf "%s\\n" $reads | while read f;
+ do
+ seqtk \\
+ trimfq \\
+ $args \\
+ \$f \\
+ | gzip --no-name > ${prefix}_\$(basename \$f)
+ done
+
+ cat <<-END_VERSIONS > versions.yml
+ "${task.process}":
+ seqtk: \$(echo \$(seqtk 2>&1) | sed 's/^.*Version: //; s/ .*\$//')
+ END_VERSIONS
+ """
+}
diff --git a/modules/nf-core/seqtk/trim/meta.yml b/modules/nf-core/seqtk/trim/meta.yml
new file mode 100644
index 0000000..1177057
--- /dev/null
+++ b/modules/nf-core/seqtk/trim/meta.yml
@@ -0,0 +1,44 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/yaml-schema.json
+name: seqtk_trim
+description: Trim low quality bases from FastQ files
+keywords:
+ - trimfq
+ - fastq
+ - seqtk
+tools:
+ - "seqtk":
+ description: "Seqtk is a fast and lightweight tool for processing sequences in the FASTA or FASTQ format"
+ homepage: https://github.com/lh3/seqtk
+ documentation: https://docs.csc.fi/apps/seqtk/
+ tool_dev_url: https://github.com/lh3/seqtk
+ licence: ["MIT"]
+
+input:
+ - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - reads:
+ type: file
+ description: List of input FastQ files
+ pattern: "*.{fastq.gz}"
+
+output:
+ - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - versions:
+ type: file
+ description: File containing software versions
+ pattern: "versions.yml"
+ - reads:
+ type: file
+ description: Filtered FastQ files
+ pattern: "*.{fastq.gz}"
+
+authors:
+ - "@laramiellindsey"
diff --git a/modules/nf-core/seqtk/trim/tests/main.nf.test b/modules/nf-core/seqtk/trim/tests/main.nf.test
new file mode 100644
index 0000000..d99b6b2
--- /dev/null
+++ b/modules/nf-core/seqtk/trim/tests/main.nf.test
@@ -0,0 +1,65 @@
+nextflow_process {
+
+ name "Test Process SEQTK_TRIM"
+ script "modules/nf-core/seqtk/trim/main.nf"
+ process "SEQTK_TRIM"
+
+ tag "modules"
+ tag "modules_nfcore"
+ tag "seqtk"
+ tag "seqtk/trim"
+
+ test("Single-end") {
+
+ when {
+ params {
+ outdir = $outputDir
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test', single_end:true ], // meta map
+ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true)
+ ]
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match()}
+ )
+ }
+
+ }
+
+test("Paired-end") {
+
+ when {
+ params {
+ outdir = $outputDir
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true),
+ file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true)
+ ]
+ ]
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(process.out).match()}
+ )
+ }
+
+ }
+
+}
diff --git a/modules/nf-core/seqtk/trim/tests/main.nf.test.snap b/modules/nf-core/seqtk/trim/tests/main.nf.test.snap
new file mode 100644
index 0000000..da181dc
--- /dev/null
+++ b/modules/nf-core/seqtk/trim/tests/main.nf.test.snap
@@ -0,0 +1,78 @@
+{
+ "Single-end": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test_test_1.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec"
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,d061ca0231d089b087e22d2001cd7c32"
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test_test_1.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec"
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,d061ca0231d089b087e22d2001cd7c32"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "23.10.1"
+ },
+ "timestamp": "2024-05-03T06:10:55.544977"
+ },
+ "Paired-end": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_test_1.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec",
+ "test_test_2.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42"
+ ]
+ ]
+ ],
+ "1": [
+ "versions.yml:md5,d061ca0231d089b087e22d2001cd7c32"
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_test_1.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec",
+ "test_test_2.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42"
+ ]
+ ]
+ ],
+ "versions": [
+ "versions.yml:md5,d061ca0231d089b087e22d2001cd7c32"
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.8.4",
+ "nextflow": "23.10.1"
+ },
+ "timestamp": "2024-05-03T06:11:38.487227"
+ }
+}
\ No newline at end of file
diff --git a/modules/nf-core/seqtk/trim/tests/tags.yml b/modules/nf-core/seqtk/trim/tests/tags.yml
new file mode 100644
index 0000000..250a138
--- /dev/null
+++ b/modules/nf-core/seqtk/trim/tests/tags.yml
@@ -0,0 +1,2 @@
+seqtk/trim:
+ - "modules/nf-core/seqtk/trim/**"
diff --git a/nextflow.config b/nextflow.config
index 3895320..28b04a5 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -24,11 +24,8 @@ params {
max_multiqc_email_size = '25.MB'
multiqc_methods_description = null
-
- // FASTP options
- adapters = null
- save_trimmed_fail = false
- save_merged = false
+ // Trimming
+ skip_trim = false
// Boilerplate options
outdir = null
@@ -42,7 +39,6 @@ params {
version = false
pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/'
-
// Config options
config_profile_name = null
config_profile_description = null
diff --git a/nextflow_schema.json b/nextflow_schema.json
index bbd7c16..005be41 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -74,29 +74,19 @@
}
}
},
- "fastp_options": {
- "title": "Fastp options",
+ "process_skipping_options": {
+ "title": "Process skipping options",
"type": "object",
- "description": "Parameters for running fastp",
+ "description": "Options to skip various steps within the workflow.",
"default": "",
+ "fa_icon": "fas fa-forward",
"properties": {
- "adapters": {
- "type": "string",
- "fa_icon": "fas fa-cut",
- "description": "Fasta file with adapter sequences to be trimmed."
- },
- "save_trimmed_fail": {
+ "skip_trim": {
"type": "boolean",
- "fa_icon": "far fa-save",
- "description": "Option to save trimmed reads."
- },
- "save_merged": {
- "type": "boolean",
- "fa_icon": "far fa-save",
- "description": "Option to save merged reads."
+ "description": "Skip trimming fastq files with seqtk",
+ "fa_icon": "fas fa-chevron-circle-right"
}
- },
- "fa_icon": "fas fa-cut"
+ }
},
"institutional_config_options": {
"title": "Institutional config options",
@@ -308,7 +298,7 @@
"$ref": "#/definitions/reference_genome_options"
},
{
- "$ref": "#/definitions/fastp_options"
+ "$ref": "#/definitions/process_skipping_options"
},
{
"$ref": "#/definitions/institutional_config_options"
diff --git a/workflows/demo.nf b/workflows/demo.nf
index c69af6f..80b1246 100644
--- a/workflows/demo.nf
+++ b/workflows/demo.nf
@@ -5,7 +5,7 @@
*/
include { FASTQC } from '../modules/nf-core/fastqc/main'
-include { FASTP } from '../modules/nf-core/fastp/main'
+include { SEQTK_TRIM } from '../modules/nf-core/seqtk/trim/main'
include { MULTIQC } from '../modules/nf-core/multiqc/main'
include { paramsSummaryMap } from 'plugin/nf-validation'
include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline'
@@ -29,7 +29,7 @@ workflow DEMO {
ch_multiqc_files = Channel.empty()
//
- // MODULE: Run FastQC
+ // MODULE: Run FASTQC
//
FASTQC (
ch_samplesheet
@@ -38,18 +38,15 @@ workflow DEMO {
ch_versions = ch_versions.mix(FASTQC.out.versions.first())
//
- // MODULE: Run Fastp
+ // MODULE: Run SEQTK_TRIM
//
- ch_adapters = params.adapters ? params.adapters : []
-
- FASTP (
- ch_samplesheet,
- ch_adapters,
- params.save_trimmed_fail,
- params.save_merged
- )
- ch_multiqc_files = ch_multiqc_files.mix(FASTP.out.json.collect{it[1]}.ifEmpty([]))
- ch_versions = ch_versions.mix(FASTP.out.versions.first())
+ if (!params.skip_trim) {
+ SEQTK_TRIM (
+ ch_samplesheet
+ )
+ ch_trimmed = SEQTK_TRIM.out.reads
+ ch_versions = ch_versions.mix(SEQTK_TRIM.out.versions.first())
+ }
//
// Collate and save software versions
@@ -63,7 +60,7 @@ workflow DEMO {
).set { ch_collated_versions }
//
- // MODULE: MultiQC
+ // MODULE: MULTIQC
//
ch_multiqc_config = Channel.fromPath(
"$projectDir/assets/multiqc_config.yml", checkIfExists: true)
|