This repository describes the development of a pan-coronavirus qPCR. It's based on all available coronaviridae reference sequences in GenBank. pan_CoV_F2 should in theory work on all, while pan_CoV_F1 has a few mismatches in some of the animal CoVs. pan_CoV_F2 is newly designed, so not sure if it works yet.
Primer and gBlock sequences1:
>pan_CoV_F1
ACWCARHTVAAYYTNAARTAYGC
>pan_CoV_F2
AARTTYTAYGGHGGNTGGVA
>pan_CoV_R
TCRCAYTTNGGRTARTCCCA
>pan_CoV_gBlock
ccctactataactcaaatgaatcttaagtatgccattagtgcaaagaatagagctcgcaccgtagctggtgtctctatctgtagtactatgaccaatagacagtttcatcaaaaattattgaaatcaatagccgccactagaggagctactgtagtaattggaacaagcaaattctatggtggttggcacaacatgttaaaaactgtttatagtgatgtagaaaaccctcaccttatgggttgggattatcctaaatgtgatagagccatg
Primer and amplicon characteristics:
Tm F1: 53.5 ºC 59.9 ºC 66.6 ºC
Tm F2: 55.5 ºC 62 ºC 68.5 ºC
Tm R: 56.3 ºC 62.1 ºC 67.3 ºC
length F1 - R: 251
length F2 - R: 92
Reaction setup:
| Component | Volumes for 20ul reaction |
|---|---|
| One-Step SYBR Green Master Mix2 | 10 |
| pan_CoV_F1 or pan_CoV_F2 | 1 |
| pan_CoV_R | 1 |
| Nuclease-free water | 5.2 |
| RNA template or pan_CoV_gBlock | 2 |
| qScript One-Step RT2 | 0.8 |
qPCR conditions:
| Step | Cycle conditions |
|---|---|
| cDNA synthesis | 50ºC, 10 min |
| Taq activation | 95ºC, 5min |
| PCR cycling (40 cycles) | 95ºC, 10s |
| 60ºC, 30s3 |
Add positive samples on a 2% agarose gel along with the positive control to check if the amplicon has the expected size.