We provide a Docker image for GenomeOcean. See docker/
for more information.
# Create a new virtual environment
uv venv GO --python 3.11
source GO/bin/activate
# install required packages
uv pip install transformers[torch]==4.51.3
# install flash-attn, will take a long time if not previously compiled
MAX_JOBS=4 uv pip install --no-build-isolation flash_attn-2.7.4.post1
# alternatively, it may be possible install flash-attn without the lengthy and buggy compiling, look through the long list at https://github.com/Dao-AILab/flash-attention/releases/ for the version fits your cuda, torch, cpython and linux versions, e.g.
# wget https://github.com/Dao-AILab/flash-attention/releases/download/v2.7.4.post1/flash_attn-2.7.4.post1+cu12torch2.6cxx11abiFALSE-cp311-cp311-linux_x86_64.whl
# uv pip install --no-deps --upgrade flash_attn-2.7.4.post1+cu12torch2.6cxx11abiFALSE-cp311-cp311-linux_x86_64.whl
from source:
uv pip install -r requirements.txt
uv pip install git+https://github.com/jgi-genomeocean/genomeocean
Test installation:
# clone the repo
git clone https://github.com/jgi-genomeocean/genomeocean
# run unit tests
source GO/bin/activate
cd genomeocean/
export VLLM_WORKER_MULTIPROC_METHOD=spawn
# disable vllm v1 engine, as custom logits processors has not yet been implemented: https://github.com/vllm-project/vllm/issues/15636
export VLLM_USE_V1=0
python -m unittest unittests.py
# make sure the installation works
cd genomeocean/examples
# test embedding:
python embedding_sequences.py \
--model_dir pGenomeOcean/GenomeOcean-4B \
--sequence_file ../sample_data/dna_sequences.txt \
--model_max_length 1024 \
--batch_size 10 \
--output_file outputs/embeddings.npy
# test generation
python generate_sequences.py \
--model_dir pGenomeOcean/GenomeOcean-4B \
--promptfile ../sample_data/dna_sequences.txt \
--out_prefix outputs/generated \
--out_format fa \
--num 10 \
--min_seq_len 100 \
--max_seq_len 100 \
--temperature 1.3 \
--top_k -1 \
--top_p 0.7 \
--max_repeats 100 \
--presence_penalty 0.5 \
--frequency_penalty 0.5 \
--repetition_penalty 1.0 \
--seed 123 \
--sort_by_orf_length
GenomeOcean is compatible with all the standard HuggingFace APIs. We publish the following checkpoints on HuggingFace:
Checkpoint | Description |
---|---|
pGenomeOcean/GenomeOcean-100M | The base model with 100M parameters. Support maximum sequence length of 1024 tokens (~5,100 bp). |
pGenomeOcean/GenomeOcean-500M | The base model with 500M parameters. Support maximum sequence length of 1024 tokens (~5,100 bp). |
pGenomeOcean/GenomeOcean-4B | The base model with 4B parameters. Support maximum sequence length of 10240 tokens (~51,000 bp). |
pGenomeOcean/GenomeOcean-4B-bgcFM | The GenomeOcean-4B model finetuned on 11M biosynthetic gene clusters (BGC) sequences. Support maximum sequence length of 10240 tokens (~51,000 bp). |
pGenomeOcean/GenomeOcean-4B-Artificial-Detector | The GenomeOcean-4B model finetuned to detected GenomeOcean-generated sequences. A binary classifier where label 0 indicate artificial sequences. |
We recommend using the GenomeOcean-4B
model for general-purpose genome sequence analysis. The GenomeOcean-4B-bgcFM
model is fine-tuned on BGC sequences and can be used for BGC-related tasks. The smaller models (GenomeOcean-100M
and GenomeOcean-500M
) can be used when GPU memory is limited, but the performance may be largely compromised.
from genomeocean.llm_utils import LLMUtils
sequences = [
"GCCGCTAAAAAGCGACCAGAATGATCCAAAAAAGAAGGCAGGCCAGCACCATCCGTTTTTTACAGCTCCAGAACTTCCTTT",
"CAGTCAGTGGCTAGCATGCTAGCATCGATCGATCGATCGATCGATCGATCGATCGGTGCATGCTAGCATCGATCGATCGAA"
]
llm = LLMUtils('pGenomeOcean/GenomeOcean-4B')
embeddings = llm.predict(sequences, batch_size=2, do_embedding=True) # batch_size can be adjusted based on GPU memory and sequence length
print(embeddings.shape) # (2, 3072)
print(type(embeddings)) # numpy.ndarray
from genomeocean.generation import SequenceGenerator
sequences = [
"GCCGCTAAAAAGCGACCAGAATGATCCAAAAAAGAAGGCAGGCCAGCACCATCCGTTTTTTACAGCTCCAGAACTTCCTTT",
"CAGTCAGTGGCTAGCATGCTAGCATCGATCGATCGATCGATCGATCGATCGATCGGTGCATGCTAGCATCGATCGATCGAA"
]
seq_gen = SequenceGenerator(
model_dir='pGenomeOcean/GenomeOcean-4B', # model_dir can also be the path to a local copy of the model
prompts=sequences, # Provide a list of DNA sequences as prompts
promptfile='', # or provide a file contains DNA sequences as prompts
num=10, # number of sequences to generate for each prompt
min_seq_len=100, # minimum length of generated sequences in token, set it as expected bp length // 4 (e.g., set it as 1000 for 4kb)
max_seq_len=100, # maximum length of generated sequences in token, max value is 10240
temperature=1.3, # temperature for sampling
top_k=-1, # top_k for sampling
top_p=0.7, # top_p for sampling
presence_penalty=0.5, # presence penalty for sampling
frequency_penalty=0.5, # frequency penalty for sampling
repetition_penalty=1.0, # repetition penalty for sampling
seed=123, # random seed for sampling
)
all_generated = seq_gen.generate_sequences(
prepend_prompt_to_output=True, # set to False to only save the generated sequence
max_repeats=0, # set to k to remove sequences with more than k% simple repeats, set to 0 to return all the generated sequences
)
seq_gen.save_sequences(
all_generated,
out_prefix='debug/seqs', # output file prefix, the final output file will be named as path/to/output.txt or path/to/output.fa
out_format='txt' # or 'fa' for fasta format,
)
Generate 100 BGCs in zero-shot mode
go_generate.py --model bgc --zero_shot --preset creative_long --num 100
Autocomplete a known siderophore BGC from MIBiG (https://mibig.secondarymetabolites.org/repository/BGC0000947.5)
go_generate.py --model bgc --prompts CGTTTAAAAATAGTGGAAGATCGGCGGTTCATGCATCAAGAAGTTTTGATGGGAGATGTTCCACGCATAGGCGCCCGCTAAGGTAAACACAACGTAATCACCAATATCGACGTGGGCGACGTGTTGATTGCGTGCCAGCACATCTTTGGGCGTACAAAGCTGGCCGACAAAGGTCGCTTGTGCATGCTGAATTGGATGAGAAATCTCATGGTGTTGCTCGCTTTTCAGGATGACGAATGGATGATCATGGCTCTGCGCCGCTGGCGTGCGGAAGTGGTGAGTTCCTCCGCGCGCGATGACAAAGTTTTCGCCAAGATTTTGTTTAATATCCAGTACTTCCATCACGTAATAACCGCATGCCGCCGTGATGAAACGTCCGCATTCAAAACGCAGTGTCCAGTCTTGCACTTGCTCTTTGGCGATGAGGAATTCCAACTTGTCGCAAAACTCCATCCACGGAAAGTGTTGCTCAGGGTTTTGGTAGTTAATCCCCATACCGCCGCCCAAGTTGATCATCAGCTCACTGAGTTTGAACTCCTGCTGCCACGTTTTCACGACTTGGAAATAGCGCTGCATTAACGCTAAGTGACGTTCAACATCGAGCTGATGCGACATCAAGTGAAAATGGAAGCCTTTGAGTGACACTTGCGGGAAATCGCGCAGCAACATCAAAGCATTACTCAGCTCGGACTCGTCCAAGCCAAATGGAGTCGGCTTGCCACCCATCGCCAACTTGCTGAGCGTGATGTCGCCAATATCGATGTTCATACGCA --preset conservative_long --num 100
This will produce a pickle file containing a dictionary, with contig ID as keys and loss scores as values in the form of a numpy array.
Calculate per base loss scores using the base model
go_scan.py input_genome.fna.gz output_pkl_prefix
Calculate per base loss scores using the combined bgc and base model (as in the paper)
go_scan.py --mode bgc_substracted input_genome.fna.gz output_pkl_prefix
please see the folder examples/
# Load model
import torch
from transformers import AutoModelForCausalLM, AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained(
"pGenomeOcean/GenomeOcean-4B",
trust_remote_code=True,
padding_side="left",
)
model = AutoModelForCausalLM.from_pretrained(
"pGenomeOcean/GenomeOcean-4B",
trust_remote_code=True,
torch_dtype=torch.bfloat16,
attn_implementation="flash_attention_2",
).to("cuda")
# Embedding
sequences = [
"GCCGCTAAAAAGCGACCAGAATGATCCAAAAAAGAAGGCAGGCCAGCACCATCCGTTTTTTACAGCTCCAGAACTTCCTTT",
"CAGTCAGTGGCTAGCATGCTAGCATCGATCGATCGATCGATCGATCGATCGATCGGTGCATGCTAGCATCGATCGATCGAA"
]
output = tokenizer.batch_encode_plus(
sequences,
max_length=10240,
return_tensors='pt',
padding='longest',
truncation=True
)
input_ids = output['input_ids'].cuda()
attention_mask = output['attention_mask'].cuda()
model_output = model.forward(input_ids=input_ids, attention_mask=attention_mask)[0].detach().cpu()
attention_mask = attention_mask.unsqueeze(-1).detach().cpu()
embedding = torch.sum(model_output * attention_mask, dim=1) / torch.sum(attention_mask, dim=1)
print(f"Shape: {embedding.shape}") # (2, 3072)
# Generation
sequences = [
"GCCGCTAAAAAGCGACCAGAATGATCCAAAAAAGAAGGCAGGCCAGCACCATCCGTTTTTTACAGCTCCAGAACTTCCTTT",
"CAGTCAGTGGCTAGCATGCTAGCATCGATCGATCGATCGATCGATCGATCGATCGGTGCATGCTAGCATCGATCGATCGAA"
]
input_ids = tokenizer(sequence, return_tensors='pt', padding=True)["input_ids"]
input_ids = input_ids[:, :-1].to("cuda") # remove the [SEP] token at the end
model_output = model.generate(
input_ids=input_ids,
min_new_tokens=10,
max_new_tokens=10,
do_sample=True,
top_p=0.9,
temperature=1.0,
num_return_sequences=1,
)
generated = tokenizer.decode(model_output[0]).replace(" ", "")[5+len(sequence):]
print(f"Generated sequence: {generated}")
Please submit pull requests and issues to the main branch.
Zhou, Zhihan, et al. "GenomeOcean: An Efficient Genome Foundation Model Trained on Large-Scale Metagenomic Assemblies." bioRxiv (2025): 2025-01. (https://www.biorxiv.org/content/10.1101/2025.01.30.635558v1.full)
@article{zhou2025genomeocean,
title={GenomeOcean: An Efficient Genome Foundation Model Trained on Large-Scale Metagenomic Assemblies},
author={Zhou, Zhihan and Riley, Robert and Kautsar, Satria and Wu, Weimin and Egan, Rob and Hofmeyr, Steven and Goldhaber-Gordon, Shira and Yu, Mutian and Ho, Harrison and Liu, Fengchen and others},
journal={bioRxiv},
pages={2025--01},
year={2025},
publisher={Cold Spring Harbor Laboratory}
}
genomeocean: a pretrained microbial genome foundational model (genomeoceanLLM) ” Copyright (c) 2025, The Regents of the University of California, through Lawrence Berkeley National Laboratory (subject to receipt of any required approvals from the U.S. Dept. of Energy) and Northwestern University. All rights reserved.
If you have questions about your rights to use or distribute this software, please contact Berkeley Lab's Intellectual Property Office at [email protected].
NOTICE. This Software was developed under funding from the U.S. Department of Energy and the U.S. Government consequently retains certain rights. As such, the U.S. Government has been granted for itself and others acting on its behalf a paid-up, nonexclusive, irrevocable, worldwide license in the Software to reproduce, distribute copies to the public, prepare derivative works, and perform publicly and display publicly, and to permit others to do so.