This Snakemake pipeline dedicated to Metagenomic data analysis consists out of several modules that cover a) read-based b) contig-based and c) MAG-based analyses as well as quantification, quality checks and a reporting module (which is currently under development). Naturally, it runs seamlessly on HPC systems and all required software tools are bundled in docker container and/or conda environments. Further, all required databases are pre-configured and ready to be downloaded from a central place.
This makes it straight forward and as user-friendly as it can get.
The pipeline is organised in modules, which can run one-by-one. Further, the user can also choose to run individual tools, giving full flexibility on how to use and run the pipeline.
The pipeline requires Snakemake version 9. Further, it is currently tested with the slurm executor and as such this one is also required to be installed.
In essence, it can also run with smaller Snakemake versions, but it might cause some troubles with the slurm executor and the escalation part of the resource allocation, version >8.11 were also running successfully.
Supports: SLURM executor / local execution docker/singularity/apptainer support
Since Snakemake 8, it is required to install an executor plugin to submit jobs to a queueing system of a HPC system. Please ensure you have installed the corresponding Snakemake plugins installed in case you want to submit your jobs to a queueing system
pip install snakemake-executor-plugin-cluster-generic
pip install snakemake-executor-plugin-slurm
Of course you can also install other, specific executor plugins, but this might need more adjustments to the existing files.
Depending on your Python version, you need to install a Pandas version > 2.1, there were errors when newer Python versions met older Pandas version. In case you run into obscure Pandas error, please make sure to install a newer pandas, e.g.
pip install pandas==2.2.3
You can install the pipeline by cloning this repository
The recommended setup is to have a dedicated pipeline folder (the cloned repository), that carries the functionality and which should not require any changes.
Then your project should have somewhere an own folder and the required configuration files are copied to it. The steps to perform are
# Go to the folder, to where you would like to clone the pipeline, e.g.
cd /users/fischerd/git
# First, clone the pipeline into that folder
git clone [email protected]:fischuu/Pipeline-Holoruminant-Meta.git
# In case the previous steps fails with an error that contains
# [email protected]: Permission denied (publickey)
# it indicates that you do not have a ssh key exchanged with GitHub
# and you could clone the repository then instead like this
#
# git clone https://github.com/fischuu/Pipeline-Holoruminant-Meta.git
# Setting ENV variable to get downstream code more generic (so, this is the
# directory to where you cloned the pipeline)
cd Pipeline-Holoruminant-Meta
PIPELINEFOLDER=$(pwd)
# If previous doesn't work, you can set it also manually like for example this
PIPELINEFOLDER="/users/fischerd/git/Pipeline-Holoruminant-Meta"
Next, we setup a project folder in our scratch space of the HPC, here we will run the pipeline
# Go to the project space of your HPC, e.g.
cd /scratch/project_2009831
# Create a folder for the new project
mkdir My_holor_project
cd My_holor_project
# For convenience, we set again a ENV variable, so that the code will be more generic
PROJECTFOLDER=$(pwd)
# Or manually the same thing again, in case the $(pwd) did not work for you:
PROJECTFOLDER="/scratch/project_2009831/My_holor_project"
Then we need to download the precompiled databases and reference genomes. Be prepared that this step will take some time (3 days, depending on you connection) and disc space (3TB). In case you have quick, local nvme discs, it is advisable to use them for unpacking the files, as this will significantly increase the speed.
# Change to the project folder and prepare folders
cd $PROJECTFOLDER
mkdir -p reads
mkdir -p resources/databases
mkdir -p resources/reference
# Download the various pre-prepared reference databases
cd $PROJECTFOLDER/resources/databases
wget https://a3s.fi/Holoruminant-data/2025.04.04.bakta.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.camper.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.checkm2.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.11.25.diamond.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.dram.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.eggnog.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.gtdbtk.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.humann.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.11.26.hyddb.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.kraken2.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.krona.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.metaphlan4.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.11.25.phyloflash.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.phylophlan.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.singlem.tar.gz
wget https://a3s.fi/Holoruminant-data/2025.04.04.sylph.tar.gz
wget https://a3s.fi/eggnog7_annotator/eggnog7_20251223_master_search_table.tsv.gz
wget https://a3s.fi/eggnog7_annotator/eggnog7_20251223_proteins.dmnd
mkdir -p eggnog7
mv eggnog7_20251223_master_search_table.tsv.gz eggnog7/
mv eggnog7_20251223_proteins.dmnd eggnog7/
# Unpack all the databases
tar -xvf 2025.04.04.bakta.tar.gz
tar -xvf 2025.04.04.camper.tar.gz
tar -xvf 2025.04.04.checkm2.tar.gz
tar -xvf 2025.11.25.diamond.tar.gz
tar -xvf 2025.04.04.dram.tar.gz
tar -xvf 2025.04.04.eggnog.tar.gz
tar -xvf 2025.04.04.gtdbtk.tar.gz
tar -xvf 2025.04.04.humann.tar.gz
tar -xvf 2025.11.26.hyddb.tar.gz
tar -xvf 2025.04.04.kraken2.tar.gz
tar -xvf 2025.04.04.krona.tar.gz
tar -xvf 2025.04.04.metaphlan4.tar.gz
tar -xvf 2025.04.04.phylophlan.tar.gz
tar -xvf 2025.11.25.phyloflash.tar.gz
tar -xvf 2025.04.04.singlem.tar.gz
tar -xvf 2025.04.04.sylph.tar.gz
# Get the reference genomes (relevant for Holoruminant) for host contamination removal
# Obviously, you can also use your own set of reference genomes here instead
cd $PROJECTFOLDER/resources
wget https://a3s.fi/Holoruminant-data/2025.04.04.reference.tar.gz
tar -xvf 2025.04.04.reference.tar.gz
# For MAGScot are also dedicated files needed, which can be pulled in a similar way
cd $PROJECTFOLDER/resources
wget https://a3s.fi/Holoruminant-data/2025.04.04.MAGScoT.tar.gz
tar -xvf 2025.04.04.MAGScoT.tar.gz
# Get the example read data
cd $PROJECTFOLDER
wget https://a3s.fi/Holoruminant-data/2025.11.25.reads.tar.gz
tar -xvf 2025.11.25.reads.tar.gz
If you have downloaded the resources already into another project, you can share the resources also to a new project, e.g. by creating a symbolic link
cd $PROJECTFOLDER
ln -s /project/with/existing/resources resources
Now we copy the configuration files from the pipeline folder to the project folder, to adjust the configurations to the project specifics
cd $PIPELINEFOLDER
cp -r config $PROJECTFOLDER
cp -r run_Pipeline-Holoruminant-meta.sh $PROJECTFOLDER
The tar-balls were created with this command (here example for diamond)
tar -czf "$(date +%Y.%m.%d).diamond.tar.gz" -C resources/databases diamond
tar -czf "$(date +%Y.%m.%d).reads.tar.gz" reads
This is the pipeline starting wrapper script. It takes care of enabling Snakemake (e.g. in case you have it as a module on your server) and also wraps the Snakemake options nicely. Furthermore, it handles to setup the environment variables for tmp and cache folders of apptainer or singularity and also can be used to prepare the rulegraph.
Enter the required values and paths according to the comments in the file.
Here are the paths to the different configuration files stored, which might not need any adjustments from the user (e.g. for Holoruminant users).
In addition, the specs for the resource set allocations are provided here. The defaults are currently not calibrated and need still some closer evaluation. Adjust the values to your needs and names from your hpc (like queue names).
Please, check also the escalation.yaml file, which organises the escalation levels for all rules.
Starting from version 0.4.30 you can also provide already assembled genomes to the pipeline. For that,
you can choose any other name than "metaspades" or "megahit" in assembler. Further you would need to
create a folder in results/assemble/<name> where <name> corresponds to the same entry you picked
in the config file. For example, you created assemblies with some long-read pipeline (e.g. this one
here: https://github.com/fischuu/Snakebite-Long_metaG) you could put into the config under assembler
assembler: "long_reads" and then you would prepare the folder
mkdir -p $PROJECTFOLDER/results/assemble/long_reads
Then, you can provide the assemblies as gezipped fasta files, in the format
{assembly_id}.fa.gz
where {assembly_id} refers to the assembly_id provided in the sample.tsv file.
In the escalation.yaml file are the different rules and their order of esclation. In case a rule fails, the slurm executor resubmits the rule with the next resource set defined in this file. In case that you cannot use the slurm exeutor you need to check if resubmission is possible with your choice of executor. If this is not possible, you can shorten here the entries to single resource sets to work.
Here we can adjust the reference genomes and databases that should be used from the pipeline. The
current defaults are for the Holoruminant project and have as such a very specific set of reference
genomes that are used for filtering and checking contaminations. Adjust yours in the hosts: section.
Take care of the order of the decontamination and bear in mind that each step are reads filtered out for the next phase. Hence, the order matters in case you want to analyse latter the level of different contaminations!
Here, you can just use a own name, followed by colon and the path to it. Reference genomes are expected to be gzipped.
In the databases: section the paths to the corresponding databases are used. The default paths meet
the folder structure you will obtain, when you download the databases from our server. The main adjustments
to do are a) the kraken path and b) phylophlan. Here, sub-databases can be given and the tools run one
after another the searches against these databases. In case of kraken, we provide a small standard
database as well as a rather large one called refseq500. Just comment out the ones you do not want to use.
Here are the HPC profiles stored. The current default configuration is adjusted to our system called Puhti and is located in the subfolder Puhti/ in the file config.yaml. For your own system, create a new subfolder with the name of your system and copy the config file from Puhti/ there to adjust. Please do not rename the yaml file, it needs to be config.yaml.
Here, set your typical default resources and check what requriements your generic slurm (or whatever executor you use) command has. In essence, the cluster-generic-submit-cmd needs to match the requirements of your system, e.g. the slurm_account option might be very specific on our system Puhti and might not be accepted or required on your system.
This file contains the tuning parameters of the different tools. This file is far from being complete and is currently not calibrated. So, please check if the tools use the parameters you want them to use and add if needed the parameters to the rule and the params file.
This file contains the sample information and is required by the pipeline.
The file has this structure
| sample_id | library_id | forward_filename | reverse_filename | forward_adapter | reverse_adapter | assembly_ids |
|---|---|---|---|---|---|---|
| ERR2019410 | lib1 | reads/ERR2019410_1.fastq.gz | reads/ERR2019410_2.fastq.gz | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | ERR2019410 |
| ERR2019412 | lib1 | reads/ERR2019412_1.fastq.gz | reads/ERR2019412_2.fastq.gz | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT | ERR2019412 |
where we can give the
sample_id, unique sample identifiedlibrary_id, library identifiier for repeated librariesforward_filename, relative path to the forward read file of that samplereverse_filename, relative path to the reverse read file of that sampleforward_adapter, adapter sequence from the forward readreverse_adapter, adapter sequence from the reverse readassembly_ids, group name for the co-assembly this sample should be used in
I am not sure, tbh, if currently several assembly_ids per sample are allowed, this would need to be tested.
There is a script in the script folder to create the sample sheet. For that, you can run
cd $PROJECTFOLDER
bash $PIPELINEFOLDER/workflow/scripts/createSampleSheet.sh
It should create the samples.tsv for the samples located in the reads/ folder. You might need to adjust the script maybe accoring to the names of the reads or the adapter sequences you use.
The most common error that can happen here is, that the file format from your samples is not as anticipated in the createSampleSheet.sh script. If that happens, you
will see an error similar to this one:
Looking for files in reads/...
No forward files found matching pattern *_R1_*.fastq.gz
No files found in reads/ matching the pattern *_R1_*.fastq.gz
In that case, you need to adjust your script. For that, copy it to the $PROJECTFOLDER and edit it there
cp $PIPELINEFOLDER/workflow/scripts/createSampleSheet.sh $PROJECTFOLDER
For example, for the example data it would need to be changed, as the file names are in the format <NAME>_1.fastq.gz and <NAME>_2.fastq.gz instead
of <NAME>_R1_001.fastq.gz (how it is assumed by the script). That means,you would need to adjust row numbers 20 from
for file in ${fastq_path}*_R1_*.fastq.gz; do
to
for file in ${fastq_path}*_1_subset.fastq.gz; do
and row number 26 from
reverse_file="${fastq_path}$(basename "${file/_R1_/_R2_}")"
to
reverse_file="${fastq_path}$(basename "${file/_1_subset.fastq/_2_subset.fastq}")"
and rerun the script (bash createSampleSheet.sh). Then the sample.tsv should be created successfully.
(The additional fastq part in the renaming is added to avoid confusions with other potential '_1' parts in the fie name)
In case you have several lanes for samples, you can concatenate them prior to creating the samples.tsv script with the script concatenateFiles.shwhich is in the pipeline folder workflow/scripts. Currently, you would need to run the script inside the same folder where the fastq files are located.
The pipeline can run the entire workflow at once. However, normally it is recommended to run different modules from the pipeline separated to get better control over the results and also to be able to react quicker to possible errors.
In the following it is assumed that the pipeline runs on a server that utilizes SLURM and Singularity. Other setups are also supported, but currently untested. In case you have a different setup and want to contribute a profile/configuration, please reach out.
For testing and developing, you can add to every command e.g. the option -np for a dry-run that prints the used commands.
The different module have also individual reports that can be generated by adding report_ in front of the module name, when a module is called. However, the reports are currently under developments and do not produce any reasonable output and might crash even.
Here some basic steps for the reads are performed.
Usage:
bash run_Pipeline-Holoruminant-meta.sh reads
# Generate the module report
bash run_Pipeline-Holoruminant-meta.sh report_reads
For testing, please check first the dry-run with commands printed by running the command like this
bash run_Pipeline-Holoruminant-meta.sh reads -np
For all other modules this works in a similar fashion, just add the -np-option for testing and report_ to the module to generate a report for the module (not implemented yet for all modules).
The reference host genomes are recompressed in this module
Usage:
bash run_Pipeline-Holoruminant-meta.sh reference
This module covers the quality control and triming of the reads
Usage:
bash run_Pipeline-Holoruminant-meta.sh preprocess
# Generate the module report
bash run_Pipeline-Holoruminant-meta.sh report_preprocess
The command read_annotate triggers the analysis of the read-based annotation.
Usage:
bash run_Pipeline-Holoruminant-meta.sh read_annotate
Individual tools can be called instead by running
bash run_Pipeline-Holoruminant-meta.sh read_annotate__diamond
bash run_Pipeline-Holoruminant-meta.sh read_annotate__krona
...
The underlying syntax is that an individual tool is always called by module name, followed by two underscores and the tool name. Please bear in mind that the pipeline automatically runs the required pre-steps. This syntax hold through-out the entire pipeline and can be used to run only subparts of the pipeline.
This module runs all the assembly related tasks, like creating the metagenome and then the binning and combination of different binners.
Usage:
bash run_Pipeline-Holoruminant-meta.sh assemble
After creating the assemblies, this module does the mapping of the reads and generates the quantification tables for the samples.
Usage:
bash run_Pipeline-Holoruminant-meta.sh quantify
This module is the MAG annotation workhorse, it aligns the mags against various databases and generates the annotation for them.
Usage:
bash run_Pipeline-Holoruminant-meta.sh mag_annotate
This module is running the contig based analysis from beginning to end, meaning it first predicts genes on the metagenome assembly, annotates the predicted genes with eggnog, aligns the quality filtered reads to the assembly with bowtie and then quantifies it with coverm.
Usage:
bash run_Pipeline-Holoruminant-meta.sh contig_annotate
Different modules create reports, here all reports at once can be generated. Otherwise, individual reports can also be reported after each module.
Usage:
bash run_Pipeline-Holoruminant-meta.sh report
The reads module can be started by
bash run_Pipeline-Holoruminant-meta.sh reads
and it triggers a set of rules:
This rule makes a link to the original file, with a prettier name than default
It creates output files like this
forward_= results/reads/"{sample}.{library}_1.fq.gz",
reverse_= results/reads/"{sample}.{library}_2.fq.gz",
with sample and library being taken from the sample.tsv file.
This rules creates fastqc reports for the input files and stores them also
in the results/reads folder as *.zip and *.html files.
The reference module can be started by
bash run_Pipeline-Holoruminant-meta.sh reads
This module has essentially the only function to take the gezipped host genomes and rezip them to bgzip
This function loops through the provided host genomes and then recompresses them.
The results are then stored under results/reference/hosts/
A larger subworkflow that consists of several steps. It can be run by
bash run_Pipeline-Holoruminant-meta.sh preprocess
rule _preprocess__fastp__run: Run fastp on one library. THis is essentially the quality and adapter trimming. The output of quality trimming is then fed into the host decontamination.
TODO: CHECK; WHAT DATABASE TO USE?! https://github.com/R-Wright-1/kraken_metaphlan_comparison/wiki/Downloading-databases
wget https://genome-idx.s3.amazonaws.com/kraken/k2_nt_20231129.tar.gz
https://github.com/R-Wright-1/kraken_metaphlan_comparison/wiki/Downloading-databases
rule _preprocess__kraken2__assign:
"""
Run kraken2 over all samples. Here, also the fastp reads are used, so we have not removed host contamination, when we assign kraken2 to the reads. Different databases used with kraken can be added into the configuration file features.yaml, intented after the kraken2 entry
This subworflow does a couple of things:
rule _preprocess__bowtie2__build: Build PRE_BOWTIE2 index for the host reference
rule _preprocess__bowtie2__map: Map one library to reference genome using bowtie2
rule _preprocess__bowtie2__extract_nonhost: Keep only pairs unmapped to the human reference genome, sort by name rather than by coordinate, and convert to FASTQ.
rule _preprocess__nonpareil__run: Run nonpareil over one sample. For this step, the host decontaminated reads are used! Rodriguez-R LM & Konstantinidis KT (2014). Nonpareil: A redundancy-based approach to assess the level of coverage in metagenomic datasets. Bioinformatics 30 (5): 629-635.
rule _preprocess__samtools__stats_cram: Compute the stats of a cram file using samtools stats. Here, we'll get mapping statistics for the host alignemtns.
TODO: CHECK WHAT DATABASE TO USE!!!
This part consists again out of several steps.. In details, these are
SingleM is a tool for profiling shotgun metagenomes. It has a particular strength in detecting microbial lineages which are not in reference databases. The method it uses also makes it suitable for some related tasks, such as assessing eukaryotic contamination, finding bias in genome recovery, computing ecological diversity metrics, and lineage-targeted MAG recovery.
Documentation can be found at https://wwood.github.io/singlem/
Citation
SingleM and Sandpiper: Robust microbial taxonomic profiles from metagenomic data. Ben J Woodcroft, Samuel T. N. Aroney, Rossen Zhao, Mitchell Cunningham, Joshua A. M. Mitchell, Linda Blackall, Gene W Tyson. bioRxiv 2024.01.30.578060; doi: https://doi.org/10.1101/2024.01.30.578060
rule _preprocess__singlem__pipe: Run singlem over one sample
rule _preprocess__singlem__condense: Aggregate all the singlem results into a single table
rule _preprocess__singlem__microbial_fraction: Run singlem microbial_fraction over one sample
rule _preprocess__singlem__aggregate_microbial_fraction: Aggregate all the microbial_fraction files into one tsv
For metaphlan 4 I downloaded the database like this
metaphlan --install --index mpa_vJun23_CHOCOPhlAnSGB_202403 --bowtie2db metaphlan4/
metaphlan ERR2019411_1.fastq.gz,ERR2019411_2.fastq.gz --bowtie2out metagenomeERR.bowtie2.bz2 --nproc 20 --input_type fastq -o profiled_metagenome.txt --bowtie2db metaphlan4/
The assemble module runs first several assemblers and combines then the results. It can be initiated by running
bash run_Pipeline-Holoruminant-meta.sh assemble
It contains of several subworkflows, as
rule _assemble__megahit: Run megahit over samples associated to assembly, merging all libraries in the process. This creates the co-assemblies as defined in the samples.tsv file
rule _assemble__bowtie2__build: Index a megahit assembly. Here, we prepare the megahit assembly for mapping
rule _assemble__bowtie2__map: Map one sample to one megahit assembly. Here, we map then the samples to the megahit assemblies
rule _assemble__concoct: This one takes all available assemblies and runs concot for them
rule _assemble__maxbin2__run: """Run MaxBin2 over a single assembly, so for each assembly, we get the bins produced from maxbin2
rule _assemble__metabat2__run: Run metabat2 end-to-end on a single assembly, for all assemblies then
rule _assemble__drep__separate_bins: This one takes the magscot output and separates the bins
rule _assemble__drep__run: Dereplicate all the bins using dRep. This is the depreplication step for the bins
rule _assemble__drep__join_genomes: Join all the dereplicated genomes into a single file.
rule _assemble__magscot__prodigal: Run prodigal over a single assembly. So, we predict for each assembly the genes.
rule _assemble__magscot__hmmsearch_pfam: Run hmmsearch over the predicted proteins of an assembly using Pfam as database
rule _assemble__magscot__hmmsearch_tigr:
Run hmmsearch over the predicted proteins of an assembly using TIGR as database
CHECK HOW TO GET THE TIGR DATABASE!!!
rule _assemble__magscot__join_hmms: Join the results of hmmsearch over TIGR and Pfam
rule _assemble__magscot__merge_contig_to_bin: Merge the contig to bin files from CONCOCT, MaxBin2 and MetaBAT2
rule _assemble__magscot__run: Run MAGSCOT over one assembly
rule _assemble__magscot__rename: Rename the contigs in the assembly to match the assembly and bin names
The quantify module quantifies the different assemblies and bins. You can use it like this
bash run_Pipeline-Holoruminant-meta.sh quantify
rule _quantify__bowtie2__build: Index dereplicated genomes /mag
rule _quantify__bowtie2__map: Align one sample to the dereplicated genomes
rule _quantify__coverm__genome: Run CoverM genome for one library and one mag catalogue
rule _quantify__coverm__genome_aggregate: Run coverm genome and a single method
rule _quantify__coverm__contig: Run coverm contig for one library and one mag catalogue
rule _quantify__coverm__contig_aggregate: Run coverm contig and a single method
rule _quantify__samtools__stats_cram: Get stats from CRAM files using samtools stats.
This module takes care of the annotation steps
bash run_Pipeline-Holoruminant-meta.sh annotate
rule annotate__quast: Run quast over one the dereplicated mags
rule _annotate__gtdbtk__classify: Run GTDB-Tk over the dereplicated genomes
TODO: THE DATABASE NEEDS TO BE FETCHED AUTOMATICALLY, CURRENTLY THE USER NEEDS TO DO IT!
TODO: UPDATE TO 2.4.0 (use release 220 instead)
wget https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.0/auxillary_files/gtdbtk_r214_data.tar.gz
rule _annotate__dram__annotate: Annotate dereplicate genomes with DRAM
rule _annotate__dram__distill: Distill DRAM annotations
TODO: ALSO HERE THE DB NEEDS TO BE INSTALLED MANUALLY! This needs quite much resources, so run it best in a sbatch script
#!/bin/bash #SBATCH --job-name=create_dram_db #SBATCH --account=project_2009831 #SBATCH --partition=hugemem #SBATCH --nodes=1 #SBATCH --cpus-per-task=40 #SBATCH --mem=800G #SBATCH --time=24:00:00 #SBATCH --output=create_dram_db.out #SBATCH --error=create_dram_db.err
singularity shell -B /scratch,/projappl,/users,/dev/shm:/tmp,/run:/run .snakemake/singularity/675d014754a2522c1e382e4b6f21b014.simg DRAM-setup.py export_config > my_old_config.txt export DRAM_CONFIG_LOCATION=my_old_config.txt DRAM-setup.py prepare_databases --output_dir resources/databases/dram/20230811/
rule _annotate__checkm2__predict: Run CheckM2 over the dereplicated mags Install the database manually first
Apptainer> DRAM-setup.py export_config > /scratch/project_2009831/Pipe_dev/my_dram_config.txt Apptainer> export DRAM_CONFIG_LOCATION=/scratch/project_2009831/Pipe_dev/my_dram_config.txt Apptainer> DRAM-setup.py prepare_databases --output_dir /scratch/project_2009831/Pipe_dev/resources/databases/dram/20230811/
WrightonLabCSU/DRAM#26 (comment)
The bakta database I downloaded is 5.1: https://zenodo.org/records/10522951
There is a benchmark output in some (and hopefully soon in all) rules, that uses the snakemake benchmark directive, which in turn uses the psutils tool and that generates a tab-separated output file with the follwoing content regarding memory and time consumption as well as I/O pressure:
| Column | Type (Unit) | Description |
|---|---|---|
s |
float (seconds) | Running time in seconds |
h:m:s |
string (-) | Running time in hour, minutes, seconds format |
max_rss |
float (MB) | Maximum Resident Set Size — the non-swapped physical memory a process has used |
max_vms |
float (MB) | Maximum Virtual Memory Size — the total amount of virtual memory used by the process |
max_uss |
float (MB) | Unique Set Size — memory unique to a process, which would be freed if the process terminated |
max_pss |
float (MB) | Proportional Set Size — shared memory divided proportionally among processes that share it (Linux only) |
io_in |
float (MB) | Number of MB read (cumulative) |
io_out |
float (MB) | Number of MB written (cumulative) |
mean_load |
float (-) | CPU usage over time, divided by the total running time (first row) |
cpu_time |
float (-) | CPU time summed for user and system |
fastpkraken2SingleMNonpareilbowtie2samtoolsMEGAHITCONCOCTMaxBin2MetaBat2MAGScoTdRepQUASTGTDB-TKDRAMCoverMFastQCmultiqc
This pipeline is a fork from the Snakemake workflow
https://github.com/3d-omics/mg_assembly/
and tailored and extended to the needs of the Holoruminant project.
