Skip to content

Session 11: Practice 3

Juan Gonzalez-Gomez edited this page Mar 4, 2020 · 30 revisions

Session 11: Practice 3

  • Time: 2h
  • Date: Wednesday, March-04th-2020
  • Goals:
    • Practicing on the programming of servers
    • Develop our own server for working with DNA sequences

Contents

Introduction

The goal of this practice is to develop our own Seq server for working with DNA sequences. We have been working with DNA sequences for many sessions, but always in our local computer. Now we will make these calculations available to other applications on Internet

The first step is to define the set of rules and commands that the clients need to follow in order to access the services given by our server: we should define the protocol

Service name Request message Argument Response message Description
PING "PING" none "OK" Ping service for testing if the server is alive of not
GET "GET n" n: 0-4 A sequence Get the sequence n. It could be any valid sequence of any length. There are only 5 sequences, numbered from 0 to 4
INFO "INFO seq" seq: A sequence See format below Get information about the given sequence: total length, number of bases and their percentages
COMP "COMP seq" seq: A sequene The complement sequence Calculate the complement of the given sequence
REV "REV seq" seq: A sequence The reverse sequence Calculate the reverse of the given sequence
GENE "GENE name" Gene name. See format below The sequence of the gene Get the complete sequence of the given GENE

The response message returned by the INFO service should be like this example:

Sequence: ATAGACCAAACATGAGAGGCT
Total length: 21
A: 9 (42.9%)
C: 4 (19.0%)
G: 5 (23.8%)
T: 3 (14.3%)

The names of the genes that are valid when calling the GENE service are: U5, ADA, FRAT1, FXN, RNU6_269P

The server will be programmed step by step, following the guides given in the exercises

Localhost IP address

TODO

Exercises

We will implement the Seq Server and develop some example clients for testing it. While developing the server, we will use the printf and nc linux commands for sending messages to the server. But you can also do it from your own client, if you like

The server will be stored in the Seq-Server.py file inside folder P3

you should use the Seq1 module developed in practice 1

Exercise 1: PING

  • Filename: P3/Seq-Server.py

Let's start by programming a server that implements the PING command. The client will send a message with the word PING. Then, the server should parse the request message. If the PING command is detected, it should generate the response message "OK!\n". Also, it should print on the console the message "PING command!" in GREEN, and then the response message in white

For testing the server we use this command, executed from the command line:

printf "PING" | nc 127.0.0.1 8080

This is what we will see on the linux console:

And this is what we should get in the Server's console:

Exercise 2: GET

  • Filename: P3/Seq-Server.py

Modify the Seq server for implementing the GET command. The client sends a message with the word GET followed by a number between 0 and 4. The server will return a response message with a sequence associated to that number. These sequences are for testing purposes, therefore you can use whatever sequences you want. They should be stored into a list. The server uses the number received in the GET command for accessing this list and returning the sequence

For testing the server we use this command, executed from the command line:

printf "GET 2" | nc 127.0.0.1 8080

In this example the client is asking for the sequence number 2

This is what is shown in the Linux's console:

And this is what we should get in the Server's console:

Exercise 3: INFO

  • Filename: P3/Seq-Server.py

Modify the Seq server for implementing the INFO command. The client sends a message with the word INFO followed by a sequence. The server will return a response message with information about that sequence. This information should be obtained using the Seq Class

For testing the server we use commands like this, executed from the Linux's command line:

printf "INFO AACCGTA" | nc 127.0.0.1 8080

This is what is shown in the Linux's console:

And this is what we should get in the Server's console:

Exercise 4: COMP

  • Filename: P3/Seq-Server.py

Modify the Seq server for implementing the COMP command. The client sends a message with the word COMP followed by a sequence. The server will return a response message with the complement of that sequence. It should be obtained using the Seq Class

For testing the server we use commands like this, executed from the Linux's command line:

printf "COMP AACCGTA" | nc 127.0.0.1 8080

This is what is shown in the Linux's console:

And this is what we should get in the Server's console:

Exercise 5: REV

  • Filename: P3/Seq-Server.py

Modify the Seq server for implementing the REV command. The client sends a message with the word REV followed by a sequence. The server will return a response message with the reverse of the given sequence. It should be obtained using the Seq Class

For testing the server we use commands like this, executed from the Linux's command line:

printf "REV AACCGTA" | nc 127.0.0.1 8080

This is what is shown in the Linux's console:

And this is what we should get in the Server's console:

Exercise 6: GENE

  • Filename: P3/Seq-Server.py

Modify the Seq server for implementing the GENE command. The client sends a message with the word REV followed by a gene name: U5, ADA, FRAT1, FXN or RNU6_269P. The server will return a response message with the complete sequence of that gene. It should be obtained using the Seq Class (and reading the gene from the corresponding file)

For testing the server we use commands like this, executed from the Linux's command line:

printf "GENE U5" | nc 127.0.0.1 8080

This is what is shown in the Linux's console:

And this is what we should get in the Server's console:

Exercise 7: Test client

TODO

END of the session

The session is finished. Make sure, during this week, that everything in this list is checked!

  • You have all the items of the session 10 checked!
  • Your working repo contains the P3 Folder with the following files:
    • Seq-server.py
  • All the previous files have been pushed to your remote Github repo

Author

Credits

  • Alvaro del Castillo. He designed and created the original content of this subject. Thanks a lot :-)

License

Links

Clone this wiki locally