Session 17: Practice 6
- Time: 2h
- Date: Wednesday, March-25th-2020
-
Goals:
- Practicing with forms
- Practicing with servers
The goal of this practice is to develop the second version of the Seq server developed in practice 3, but using the HTTP python module instead of raw sockets and accessing to its services by means of HTML forms
This table describe the names of the actions and their parameters
| Service name | Action | Argument | Response message | Description |
|---|---|---|---|---|
| PING | ping | none | OK. See exercise 1 | Ping service for testing if the server is alive of not |
| GET | get | n: 0-4 | A sequence. See exercise 2 | Get the sequence n. It could be any valid sequence of any length. There are only 5 sequences, numbered from 0 to 4 |
| GENE | gene | name: U5, ADA, FRAT1, RNU6_269P, FXN | The sequence of the gene. See exercise 3 | Get the complete sequence of the given GENE |
| OPERATION | operation | seq: A sequence, op: Operation to perform: info, comp, rev | See exercise 4 | Perform the operation on the given sequence. INFO: Get more info, COMP: Calculate the complement, REV: Calculate the rev sequence |
The response message returned by the INFO service should be like this example:
Sequence: ATAGACCAAACATGAGAGGCT
Total length: 21
A: 9 (42.9%)
C: 4 (19.0%)
G: 5 (23.8%)
T: 3 (14.3%)
The names of the genes that are valid when calling the GENE service are: U5, ADA, FRAT1, FXN, RNU6_269P
As always, we will develop this server step by step, in the Seq2-server.py file. It will be extended in every exercise (but working on the same file)
Implement the ping service in the server. It should return a response message with a page saying that the server is alive. It should include a link to the main page. If a different resource is requested an Error web page is returned
- Server Filename: P6/Seq2-server.py
- HTML file: P6/form-1.html
- HTML file: P6/Error.html
In this animation you can see it working:
Extend the previous server for implementing the get service. It should return the requested sequence (0 - 4). A response message with a page with the sequence is generated. It should include a link to the main page
- Server Filename: P6/Seq2-server.py
- HTML file: P6/form-2.html
This is how it should work:
Extend the previous server for implementing the gene service. It should return the requested gene by its name. A response message with a page with the gene is generated. It should include a link to the main page
- Server Filename: P6/Seq2-server.py
- HTML file: P6/form-3.html
This is how it should work:
Extend the previous server for implementing the operation service. It should return the requested operation on the sequence introduced. There are three operation: Info about the sequence, its complement and its reverse . A response message with a page with the results of the operation is generated. It should include a link to the main page
- Server Filename: P6/Seq2-server.py
- HTML file: P6/form-4.html
This is how it should work:
The session is finished. Make sure, during this week, that everything in this list is checked!
- You have all the items of the session 16 checked!
- Your working repo contains the P6 Folder with the following files:
- Seq2-server.py
- Error.html
- form-1.html
- form-2 html
- form-3 html
- form-4 html
- All the previous files have been pushed to your remote Github repo
- Juan González-Gómez (Obijuan)
- Alvaro del Castillo. He designed and created the original content of this subject. Thanks a lot :-)
