Session 4: The ensembl genome browser

Session 4: The ensembl genome browser

• Time: 2h
• Date: Tuesday, Feb-11th-2020
• Goals:
  • Learn about the Ensembl database
  • Know how to download dna sequences from Emsembl
  • Practicing with real dna sequence files

Contents

• Introduction
• Architecture
• Formats
• Playing with Ensembl
  • Accesing the Human gnome
  • Accesing a single gene
• Exercises
  • Exercise 1
  • Exercise 2
  • Exercise 3
  • Exercise 4
  • Exercise 5
• End of the session
• Author
• Credits
• License

Introduction

ensembl.org is one of several well known genome browsers for the retrieval of genomic information. It can be directly used from the web page. But, It can also be used by accessing directly to its databases by means of a Rest API

You can find more information in the Ensambl wikipedia page

As BIO-specialists, you should be able to use the databases and understand the underlying concepts: genome, DNA, bases and so on. Concepts that computer scientists and Electronic Engineers are not familiar with

As Engineers, you should understand the technology behind these databases: the networks, the internet architecture, the protocols, the formats... and how to create applications that can access these databases. This is what this subject, the Programming in Network Environments, is about

Architecture

This is a drawing of the main ideas of the architecture we are using in this subject

We have the Ensembl database, that is located anywhere on the internet. It has a lot of information about the vertebrates gnome. There is also a server that is capable of accessing to this huge database and give the information to us. On one hand, any user can access this database using the browser. In this case the server is showing web pages. On then other hand, the server can also give that information to other apps on the internet (not users)

We will learn how to create python clients capable of accessing to this information. We will also learn how to create python apps that are both a client and a server. On one side they offer a service to both users/apps. On the other side they are client that ask for information to the Ensembl database, process it and return it to the user/app

We have to learn the terminology and all the protocols, data formats and APIs for implementing it in our python apps

Formats

The information located in the databases is available in different formats. The most important are:

• FASTA: for representing either nucleotide sequences or peptide sequences. This is a format used in Bioinformatics applications
• JSON: Generic format for representing any data object
• XML: is a markup language that defines a set of rules for encoding documents in a format that is both human-readable and machine-readable

As Engineers we should understand that formats, and to be able to create programs for reading data in those formats, and to write information with them

Playing with Ensembl

Just to get familiar with the Ensembl web page, Let's play a little bit using the browser

• Enter into the ensembl.org web page
• Let's have a look of all the species available in the database. Click on View full list of all Ensembl species

Accesing the Human gnome

• There appear a list of all the species. Write human on the right for shortening the list, and then click on the human link

• The page of the human gnome is shown in the browser. Let's have a look at the Human karyotype. Click on the view karyotype option

• We can see now all the chromosomes of the Human gnome. Let's click on the Chromose number 16, for example

• We see a summary of the chromose. Let's select now a zone, with the mouse, near the the q21 region. Then click on Jump to region overview

• In the new panel, below, you will find the names of the genes located on that region. Choose one, for example the RNU6-269P

• Then click on Gene ID. We want to have more information about this gene

https://github.com/myTeachingURJC/2019-2020-PNE/raw/master/s4-ensemble/ensembl-07.png

• The summary page of that gene is shown. Now click on the left, on the Sequence option

• On the bottom left we can see a new button for downloading that sequence

• We select the FASTA format (the default) and click on Download

• A file called Homo_sapiens_RNU6_269P_sequence.fa will be download. We chose the Save File option and click on OK

• After some seconds we will see the file available on the folder were it was saved (in this example it is located in the Download directory)

• Just doble click on it from the file manager to open it. You are seeing all the bases of the RNU6-269P gene! Congrats! You've downloaded your fist gene sequence! :-)

Now that we have that file with the bases, we can perform calculations such as the total number and the percentages of each base. We will write python programs to do it automatically

Accesing a single gene

It is also possible to download the sequence of a Gene just knowing its name. Let's have a look at the human Gnome in wikipedia

Scroll down until the section called Molecular organization and gene content. There we can see all the chromosomes

Click on the Chromosome number 10

There you will see all the information related to this chromosome. On the right you can also find a link to the ensembl database. Let's scroll down to the Gene List section first

You can see there the names of all the genes located in the Chromose 10. Let's find the FRAT1 gene, for example, and click on it to see more information:

Scroll down the page. On the right side there is a summary of the Gene. You will find there a link to the gene in the Ensembl database

You will see the page in Ensembl, similar to the one that we already saw. Just click on the Sequence option on the left and repeat the previous process for downloading the FRAT1 gene sequence to a file

You can also go to the Emsambl main page and enter search for the FRAT1 gene:

Then press the GO button. The first entry is what we are looking for:

That link will take us directly to the previous FRAT1 Ensembl page, were we can download the FRAT1 gene

Exercises

Let's practice with the ensembl database. Create the Session-04 folder in your working repository. Store all the files create during this session (exercises and sequences)

Exercise 1

Get from the Ensembl database the following sequences of the given Genes:

• RNU6_269P gene, from Chromose 16 of the Human gnome
  • Filename: Session-04/RNU6_269P.txt
• FRAT1. Chromosome 10. Human Gnome
  • Filename: Session-04/FRAT1.txt
• U5. Clown anemonefish
  • Filename: Session-04/U5.txt
• ADA. Human Gnome. In which Chromosome is found?
  • Filename: Session-04/ADA.txt
• FXN. Cat Gnome. In which Chromosome is found?
  • Filename: Session-04/FXN.txt

Exercise 2

From now on, we will use the module Path from the Pathlib library for accessing the files. This is a very simple and modern way of working with files and paths

• Filename: Session-04/print_file.py
• Description: This program just opens a text file (for example a dna file) and prints the contents on the console. The goal is to get familiar with the Path module. This exercise is already solve for your. Just try it and make sure you understand it. No error control is implemented yet

from pathlib import Path

# -- Constant with the new of the file to open
FILENAME = "RNU6_269P.txt"

# -- Open and read the file
file_contents = Path(FILENAME).read_text()

# -- Print the contents on the console
print(file_contents)

Exercise 3

Have a look at the dna files that you have downloaded in the previous exercise. Notice that they consist of two parts: a head an a body. The first line is the head, which starts with the '>' symbol. The following lines are the body and contains the sequence of nucleotides

• Filename: Session-04/head.py
• Desription: Write a python program that opens the file RNU6_269P.txt and prints only its head

First line of the RNU6_269P.txt file:
>16 dna:chromosome chromosome:GRCh38:16:58377452:58378748:-1

• Considerations:
  • Do not check for error when opening the file
  • Open the file using the module Path, imported from pathlib
  • The split method is very very useful. Try it and learn about it
  • The character used for separating the lines is '\n'

Exercise 4

• Filename: Session-04/body.py
• Description: Write a program that opens the U5.txt file and prints on the console all the lines except the first one

Body of the U5.txt file:
ATAGACCAAACATGAGAGGCTGTGAATGGTATAATCTTCGCCGTTCGACAGGTAAGGTTA
TTTTTATTTTTTTTTTTTACTATTAAAGCGCTTTATAGATGTTTGTTCTTAATATTGCAG
ATTTAACTTTAACAACTCATTGTGCACGGAAACTCTCCGTTTGAGGACAGCAGTAGCAGG
...(the whole file is not shown in this output, but you should
    see it in your console) ...
TTCTTGATGCTGATGATTTAAGTCCAGTTTATGTTAACAGTGGCTAATGTTAACATAAAT
GGAACTTACATCATTAGCATTATCTCAGACCGTAATAAAATTTGAACAGTAATA

• Considerations
  • Do not check for error when opening the file

Exercise 5

• Filename: Session-04/sequence.py
• Description: Write a program that opens the ADA.txt file and writes the total number of bases (Have in mind that you should remove the new line ('\n') characters
• Considerations:
  • Remove the first line (the header) and all the '\n' characters. Then the total number of bases can be calculated using the len() function
  • The correct result is: 33912

END of the session

The session is finished. Make sure, during this week, that everything in this list is checked!

• You have all the items of the session 3 checked!
• Your working repo contains the Session-04 Folder with the following files:
  • RNU6_269P.txt
  • FRAT1.txt
  • U5.txt
  • ADA.txt
  • FXN.txt
  • print_file.py
  • head.py
  • body.py
  • sequence.py
• All the previous files have been pushed to your remote Github repo

Author

• Juan González-Gómez (Obijuan)

Credits

• Alvaro del Castillo. He designed and created the original content of this subject. Thanks a lot :-)

License

Links

• Universidad Rey Juan Carlos de Madrid
• Escuela Técnica Superior de Ingeniería de Telecomunicaciones (URJC)