Skip to content

Session 17: Practice 6

Juan Gonzalez-Gomez edited this page Mar 24, 2020 · 23 revisions

Session 17: Practice 6

  • Time: 2h
  • Date: Wednesday, March-25th-2020
  • Goals:
    • Practicing with forms
    • Practicing with servers

Contents

Introduction

The goal of this practice is to develop the second version of the Seq server developed in practice 3, but using the HTTP python module instead of raw sockets and accessing to its services by means of forms

This table describe the names of the actions and their parameters

Service name Action Argument Response message Description
PING ping none OK. See exercise 1 Ping service for testing if the server is alive of not
GET get n: 0-4 A sequence. See exercise 2 Get the sequence n. It could be any valid sequence of any length. There are only 5 sequences, numbered from 0 to 4
GENE gene name: U5, ADA, FRAT1, RNU6_269P, FXN The sequence of the gene. See exercise 3 Get the complete sequence of the given GENE
OPERATION operation seq: A sequence, op: Operation to perform: info, comp, rev See exercise 4 Perform the operation on the given sequence. INFO: Get more info, COMP: Calculate the complement, REV: Calculate the rev sequence

The response message returned by the INFO service should be like this example:

Sequence: ATAGACCAAACATGAGAGGCT
Total length: 21
A: 9 (42.9%)
C: 4 (19.0%)
G: 5 (23.8%)
T: 3 (14.3%)

The names of the genes that are valid when calling the GENE service are: U5, ADA, FRAT1, FXN, RNU6_269P

Exercises

As always, we will develop this server step by step, in the Seq2-server.py file. It will be extended in every exercise (but working on the same file)

Exercise 1: PING

Implement the ping service in the server. It should return a response message with a page saying that the server is alive. It should include a link to the main page. If a different resource is requested an Error web page is returned

  • Server Filename: P6/Seq2-server.py
  • HTML file: P6/form-1.html
  • HTML file: P6/Error.html

In this animation you can see it working:

Exercise 2: GET

Extend the previous server for implementing the get service. It should return the requested sequence (0 - 4). A response message with a page with the sequence is generated. It should include a link to the main page

  • Server Filename: P6/Seq2-server.py
  • HTML file: P6/form-2.html

This is how it should work:

Exercise 3: GENE

Extend the previous server for implementing the gene service. It should return the requested gene by its name. A response message with a page with the gene is generated. It should include a link to the main page

  • Server Filename: P6/Seq2-server.py
  • HTML file: P6/form-3.html

This is how it should work:

Exercise 4: Operation

Extend the previous server for implementing the gene service. It should return the requested gene by its name. A response message with a page with the gene is generated. It should include a link to the main page

  • Server Filename: P6/Seq2-server.py
  • HTML file: P6/form-4.html

This is how it should work:

END of the session

The session is finished. Make sure, during this week, that everything in this list is checked!

  • You have all the items of the session 14 checked!
  • Your working repo contains the P5 Folder with the following files:
    • info/A.html
    • info/C.html
    • info/G.html
    • info/T.html
    • Error.html
    • index.html
    • Bases2-webserver.py
  • All the previous files have been pushed to your remote Github repo

Author

Credits

  • Alvaro del Castillo. He designed and created the original content of this subject. Thanks a lot :-)

License

Links

Clone this wiki locally